Contents

The scanMiRData package contains KdModel collections corresponding to all human, mouse and rat mirbase miRNAs. These represent the miRNA binding affinities (or more exactly, dissociation rates) predicted using the CNN from McGeary, Lin et al. (2019). To know more about the KdModel and KdModelList classes, see the corresponding vignette in the scanMiR package.

1 Loading the collections

The objects can be loaded to the environment using data:

library(scanMiR)
data("mmu", package="scanMiRData")
summary(mmu)
## A `KdModelList` object created on 2020-11-22,
##  containing binding affinity models from 1978 miRNAs.
## Mus musculus, miRBase release 22.1
## 
##               Low-confidence             Poorly conserved 
##                         1215                          346 
##     Conserved across mammals Conserved across vertebrates 
##                          134                          203 
##                         <NA> 
##                           80
head(mmu)
## An object of class "KdModelList"
## [[1]]
## A `KdModel` for mmu-let-7a-1-3p (Low-confidence)
##   Sequence: CUAUACAAUCUACUGUCUUUCC
##   Canonical target seed: TTGTATA(A)
## [[2]]
## A `KdModel` for mmu-let-7a-2-3p (Low-confidence)
##   Sequence: CUGUACAGCCUCCUAGCUUUC
##   Canonical target seed: CTGTACA(A)
## [[3]]
## A `KdModel` for mmu-let-7a-5p (Conserved across vertebrates)
##   Sequence: UGAGGUAGUAGGUUGUAUAGUU
##   Canonical target seed: CTACCTC(A)
## [[4]]
## A `KdModel` for mmu-let-7b-3p (Low-confidence)
##   Sequence: CUAUACAACCUACUGCCUUCCC
##   Canonical target seed: TTGTATA(A)
## [[5]]
## A `KdModel` for mmu-let-7b-5p (Conserved across vertebrates)
##   Sequence: UGAGGUAGUAGGUUGUGUGGUU
##   Canonical target seed: CTACCTC(A)
## [[6]]
## A `KdModel` for mmu-let-7c-1-3p (Low-confidence)
##   Sequence: CUGUACAACCUUCUAGCUUUCC
##   Canonical target seed: TTGTACA(A)

Alternatively, they can also be loaded (and filtered) through a convenient function:

library(scanMiRData)
mmu <- getKdModels("mmu", categories=c("Conserved across vertebrates", 
                                       "Conserved across mammals"))
summary(mmu)
## A `KdModelList` object containing binding affinity models from 337 miRNAs.
## 
##               Low-confidence             Poorly conserved 
##                            0                            0 
##     Conserved across mammals Conserved across vertebrates 
##                          134                          203

Summary of the other two collections:

summary(getKdModels("hsa"))
## A `KdModelList` object containing binding affinity models from 2656 miRNAs.
## 
##               Low-confidence             Poorly conserved 
##                         1913                          290 
##     Conserved across mammals Conserved across vertebrates 
##                          136                          192 
##                         <NA> 
##                          125
summary(getKdModels("rno"))
## A `KdModelList` object containing binding affinity models from 764 miRNAs.
## 
##               Low-confidence             Poorly conserved 
##                          482                            2 
##     Conserved across mammals Conserved across vertebrates 
##                          112                          165 
##                         <NA> 
##                            3



Session info

## R version 4.2.0 RC (2022-04-21 r82226)
## Platform: x86_64-pc-linux-gnu (64-bit)
## Running under: Ubuntu 20.04.4 LTS
## 
## Matrix products: default
## BLAS:   /home/biocbuild/bbs-3.16-bioc/R/lib/libRblas.so
## LAPACK: /home/biocbuild/bbs-3.16-bioc/R/lib/libRlapack.so
## 
## locale:
##  [1] LC_CTYPE=en_US.UTF-8       LC_NUMERIC=C              
##  [3] LC_TIME=en_GB              LC_COLLATE=C              
##  [5] LC_MONETARY=en_US.UTF-8    LC_MESSAGES=en_US.UTF-8   
##  [7] LC_PAPER=en_US.UTF-8       LC_NAME=C                 
##  [9] LC_ADDRESS=C               LC_TELEPHONE=C            
## [11] LC_MEASUREMENT=en_US.UTF-8 LC_IDENTIFICATION=C       
## 
## attached base packages:
## [1] stats     graphics  grDevices utils     datasets  methods   base     
## 
## other attached packages:
## [1] scanMiRData_1.3.0 scanMiR_1.3.0     BiocStyle_2.25.0 
## 
## loaded via a namespace (and not attached):
##  [1] tidyselect_1.1.2       xfun_0.30              bslib_0.3.1           
##  [4] purrr_0.3.4            colorspace_2.0-3       vctrs_0.4.1           
##  [7] generics_0.1.2         htmltools_0.5.2        stats4_4.2.0          
## [10] yaml_2.3.5             utf8_1.2.2             rlang_1.0.2           
## [13] jquerylib_0.1.4        pillar_1.7.0           glue_1.6.2            
## [16] DBI_1.1.2              BiocParallel_1.31.0    BiocGenerics_0.43.0   
## [19] GenomeInfoDbData_1.2.8 lifecycle_1.0.1        ggseqlogo_0.1         
## [22] stringr_1.4.0          zlibbioc_1.43.0        Biostrings_2.65.0     
## [25] munsell_0.5.0          gtable_0.3.0           evaluate_0.15         
## [28] knitr_1.38             IRanges_2.31.0         fastmap_1.1.0         
## [31] GenomeInfoDb_1.33.0    parallel_4.2.0         fansi_1.0.3           
## [34] scales_1.2.0           BiocManager_1.30.17    S4Vectors_0.35.0      
## [37] jsonlite_1.8.0         XVector_0.37.0         ggplot2_3.3.5         
## [40] digest_0.6.29          stringi_1.7.6          bookdown_0.26         
## [43] dplyr_1.0.8            cowplot_1.1.1          GenomicRanges_1.49.0  
## [46] grid_4.2.0             cli_3.3.0              tools_4.2.0           
## [49] bitops_1.0-7           magrittr_2.0.3         sass_0.4.1            
## [52] RCurl_1.98-1.6         tibble_3.1.6           crayon_1.5.1          
## [55] pkgconfig_2.0.3        ellipsis_0.3.2         data.table_1.14.2     
## [58] assertthat_0.2.1       rmarkdown_2.14         R6_2.5.1              
## [61] compiler_4.2.0