Contents

1 Core infrastructure

1.1 Biostrings

DNA, amino acid, and other biological sequences. See earlier example in B.1 Introduction to Bioconductor.

1.2 GRanges

1.2.1 The GenomicRanges package

  • GRanges(): genomic coordinates to represent annotations (exons, genes, regulatory marks, …) and data (called peaks, variants, aligned reads)

    Alt GRanges

    Alt GRanges

  • GRangesList(): genomic coordinates grouped into list elements (e.g., paired-end reads; exons grouped by transcript)

    Alt GRangesList

    Alt GRangesList

1.2.2 Range operations

Alt Ranges Algebra

Alt Ranges Algebra

1.2.2.1 Ranges

  • IRanges
    • start() / end() / width()
    • List-like – length(), subset, etc.
    • ‘metadata’, mcols()
  • GRanges
    • ‘seqnames’ (chromosome), ‘strand’
    • Seqinfo, including seqlevels and seqlengths

1.2.2.2 Intra-range methods

  • Independent of other ranges in the same object
  • GRanges variants strand-aware
  • shift(), narrow(), flank(), promoters(), resize(), restrict(), trim()
  • See ?"intra-range-methods"

1.2.2.3 Inter-range methods

  • Depends on other ranges in the same object
  • range(), reduce(), gaps(), disjoin()
  • coverage() (!)
  • see ?"inter-range-methods"

1.2.2.4 Between-range methods

  • Functions of two (or more) range objects
  • findOverlaps(), countOverlaps(), …, %over%, %within%, %outside%; union(), intersect(), setdiff(), punion(), pintersect(), psetdiff()

1.2.2.5 Example

library(GenomicRanges)
gr <- GRanges("A", IRanges(c(10, 20, 22), width=5), "+")
shift(gr, 1)                            # intra-range
## GRanges object with 3 ranges and 0 metadata columns:
##       seqnames    ranges strand
##          <Rle> <IRanges>  <Rle>
##   [1]        A  [11, 15]      +
##   [2]        A  [21, 25]      +
##   [3]        A  [23, 27]      +
##   -------
##   seqinfo: 1 sequence from an unspecified genome; no seqlengths
range(gr)                               # inter-range
## GRanges object with 1 range and 0 metadata columns:
##       seqnames    ranges strand
##          <Rle> <IRanges>  <Rle>
##   [1]        A  [10, 26]      +
##   -------
##   seqinfo: 1 sequence from an unspecified genome; no seqlengths
reduce(gr)                              # inter-range
## GRanges object with 2 ranges and 0 metadata columns:
##       seqnames    ranges strand
##          <Rle> <IRanges>  <Rle>
##   [1]        A  [10, 14]      +
##   [2]        A  [20, 26]      +
##   -------
##   seqinfo: 1 sequence from an unspecified genome; no seqlengths
snps <- GRanges("A", IRanges(c(11, 17, 24), width=1))
findOverlaps(snps, gr)                  # between-range
## Hits object with 3 hits and 0 metadata columns:
##       queryHits subjectHits
##       <integer>   <integer>
##   [1]         1           1
##   [2]         3           2
##   [3]         3           3
##   -------
##   queryLength: 3 / subjectLength: 3
setdiff(range(gr), gr)                  # 'introns'
## GRanges object with 1 range and 0 metadata columns:
##       seqnames    ranges strand
##          <Rle> <IRanges>  <Rle>
##   [1]        A  [15, 19]      +
##   -------
##   seqinfo: 1 sequence from an unspecified genome; no seqlengths

1.3 GenomicAlignments

Representation of aligned reads. See exercises below.

1.4 SummarizedExperiment

1.4.1 The SummarizedExperiment package

Alt SummarizedExperiment

Alt SummarizedExperiment

  • Coordinate feature x sample ‘assays’ with row (feature) and column (sample) descriptions.
  • colData() data frame for desciption of samples
  • rowRanges() GRanges / GRangeList or data frame for description of features
  • exptData() to describe the entire object
  • assays() can be any matrix-like object, including very large on-disk representations such as HDF5Array
library(SummarizedExperiment)
library(airway)
data(airway)
airway
## class: RangedSummarizedExperiment 
## dim: 64102 8 
## metadata(1): ''
## assays(1): counts
## rownames(64102): ENSG00000000003 ENSG00000000005 ... LRG_98 LRG_99
## rowData names(0):
## colnames(8): SRR1039508 SRR1039509 ... SRR1039520 SRR1039521
## colData names(9): SampleName cell ... Sample BioSample
colData(airway)
## DataFrame with 8 rows and 9 columns
##            SampleName     cell      dex    albut        Run avgLength
##              <factor> <factor> <factor> <factor>   <factor> <integer>
## SRR1039508 GSM1275862   N61311    untrt    untrt SRR1039508       126
## SRR1039509 GSM1275863   N61311      trt    untrt SRR1039509       126
## SRR1039512 GSM1275866  N052611    untrt    untrt SRR1039512       126
## SRR1039513 GSM1275867  N052611      trt    untrt SRR1039513        87
## SRR1039516 GSM1275870  N080611    untrt    untrt SRR1039516       120
## SRR1039517 GSM1275871  N080611      trt    untrt SRR1039517       126
## SRR1039520 GSM1275874  N061011    untrt    untrt SRR1039520       101
## SRR1039521 GSM1275875  N061011      trt    untrt SRR1039521        98
##            Experiment    Sample    BioSample
##              <factor>  <factor>     <factor>
## SRR1039508  SRX384345 SRS508568 SAMN02422669
## SRR1039509  SRX384346 SRS508567 SAMN02422675
## SRR1039512  SRX384349 SRS508571 SAMN02422678
## SRR1039513  SRX384350 SRS508572 SAMN02422670
## SRR1039516  SRX384353 SRS508575 SAMN02422682
## SRR1039517  SRX384354 SRS508576 SAMN02422673
## SRR1039520  SRX384357 SRS508579 SAMN02422683
## SRR1039521  SRX384358 SRS508580 SAMN02422677
airway[, airway$dex %in% "trt"]
## class: RangedSummarizedExperiment 
## dim: 64102 4 
## metadata(1): ''
## assays(1): counts
## rownames(64102): ENSG00000000003 ENSG00000000005 ... LRG_98 LRG_99
## rowData names(0):
## colnames(4): SRR1039509 SRR1039513 SRR1039517 SRR1039521
## colData names(9): SampleName cell ... Sample BioSample
chr14 <- as(seqinfo(airway), "GRanges")["14"]
airway[airway %over% chr14,]
## class: RangedSummarizedExperiment 
## dim: 2244 8 
## metadata(1): ''
## assays(1): counts
## rownames(2244): ENSG00000006432 ENSG00000009830 ... ENSG00000273259
##   ENSG00000273307
## rowData names(0):
## colnames(8): SRR1039508 SRR1039509 ... SRR1039520 SRR1039521
## colData names(9): SampleName cell ... Sample BioSample

1.5 Annotation Resources

  • Bioconductor provides extensive access to ‘annotation’ resources (see the AnnotationData biocViews hierarchy); some interesting examples to explore during this lab include:
  • biomaRt, PSICQUIC, KEGGREST and other packages for querying on-line resources; each of these have informative vignettes.
  • AnnotationDbi is a cornerstone of the Annotation Data packages provided by Bioconductor.
    • org packages (e.g., org.Hs.eg.db) contain maps between different gene identifiers, e.g., ENTREZ and SYMBOL. The basic interface to these packages is described on the help page ?select
    • TxDb packages (e.g., TxDb.Hsapiens.UCSC.hg19.knownGene) contain gene models (exon coordinates, exon / transcript relationships, etc) derived from common sources such as the hg19 knownGene track of the UCSC genome browser. These packages can be queried, e.g., as described on the ?exonsBy page to retrieve all exons grouped by gene or transcript.
    • BSgenome packages (e.g., BSgenome.Hsapiens.UCSC.hg19) contain whole genomes of model organisms.
  • VariantAnnotation and ensemblVEP provide access to sequence annotation facilities, e.g., to identify coding variants; see the Introduction to VariantAnnotation vignette for a brief introduction.
  • Take a quick look at the annotation work flow on the Bioconductor web site.

1.5.1 Static packages

  • org.*: identifier mappings

    • select(), columns(), keys()
    • mapIds()
    library(org.Hs.eg.db)
    org <- org.Hs.eg.db
    select(org, "BRCA1", c("ENSEMBL", "GENENAME"), "SYMBOL")
    ## 'select()' returned 1:1 mapping between keys and columns
    ##   SYMBOL         ENSEMBL                     GENENAME
    ## 1  BRCA1 ENSG00000012048 BRCA1, DNA repair associated
  • TxDb.*: gene models

    • exons(), transcripts(), genes(), promoters(), …
    • exonsBy(), transcriptsBy()
    • select(), etc.
    library(TxDb.Hsapiens.UCSC.hg19.knownGene)
    txdb <- TxDb.Hsapiens.UCSC.hg19.knownGene
    promoters(txdb)
    ## GRanges object with 82960 ranges and 2 metadata columns:
    ##                 seqnames           ranges strand |     tx_id     tx_name
    ##                    <Rle>        <IRanges>  <Rle> | <integer> <character>
    ##       [1]           chr1 [  9874,  12073]      + |         1  uc001aaa.3
    ##       [2]           chr1 [  9874,  12073]      + |         2  uc010nxq.1
    ##       [3]           chr1 [  9874,  12073]      + |         3  uc010nxr.1
    ##       [4]           chr1 [ 67091,  69290]      + |         4  uc001aal.1
    ##       [5]           chr1 [319084, 321283]      + |         5  uc001aaq.2
    ##       ...            ...              ...    ... .       ...         ...
    ##   [82956] chrUn_gl000237   [ 2487,  4686]      - |     82956  uc011mgu.1
    ##   [82957] chrUn_gl000241   [36676, 38875]      - |     82957  uc011mgv.2
    ##   [82958] chrUn_gl000243   [ 9501, 11700]      + |     82958  uc011mgw.1
    ##   [82959] chrUn_gl000243   [11608, 13807]      + |     82959  uc022brq.1
    ##   [82960] chrUn_gl000247   [ 5617,  7816]      - |     82960  uc022brr.1
    ##   -------
    ##   seqinfo: 93 sequences (1 circular) from hg19 genome

1.5.2 Web-based resources

1.5.3 Genome-scale resources

library(AnnotationHub)
hub = AnnotationHub()
## snapshotDate(): 2017-04-25
hub
## AnnotationHub with 39332 records
## # snapshotDate(): 2017-04-25 
## # $dataprovider: BroadInstitute, Ensembl, UCSC, Haemcode, Inparanoid8, ft...
## # $species: Homo sapiens, Mus musculus, Bos taurus, Pan troglodytes, Dani...
## # $rdataclass: GRanges, BigWigFile, FaFile, TwoBitFile, ChainFile, Rle, I...
## # additional mcols(): taxonomyid, genome, description,
## #   coordinate_1_based, maintainer, rdatadateadded, preparerclass,
## #   tags, rdatapath, sourceurl, sourcetype 
## # retrieve records with, e.g., 'object[["AH2"]]' 
## 
##             title                                                 
##   AH2     | Ailuropoda_melanoleuca.ailMel1.69.dna.toplevel.fa     
##   AH3     | Ailuropoda_melanoleuca.ailMel1.69.dna_rm.toplevel.fa  
##   AH4     | Ailuropoda_melanoleuca.ailMel1.69.dna_sm.toplevel.fa  
##   AH5     | Ailuropoda_melanoleuca.ailMel1.69.ncrna.fa            
##   AH6     | Ailuropoda_melanoleuca.ailMel1.69.pep.all.fa          
##   ...       ...                                                   
##   AH54627 | Xiphophorus_maculatus.Xipmac4.4.2.cdna.all.2bit       
##   AH54628 | Xiphophorus_maculatus.Xipmac4.4.2.dna.toplevel.2bit   
##   AH54629 | Xiphophorus_maculatus.Xipmac4.4.2.dna_rm.toplevel.2bit
##   AH54630 | Xiphophorus_maculatus.Xipmac4.4.2.dna_sm.toplevel.2bit
##   AH54631 | Xiphophorus_maculatus.Xipmac4.4.2.ncrna.2bit
query(hub, c("ensembl", "81.gtf"))
## AnnotationHub with 69 records
## # snapshotDate(): 2017-04-25 
## # $dataprovider: Ensembl
## # $species: Ailuropoda melanoleuca, Anas platyrhynchos, Anolis carolinens...
## # $rdataclass: GRanges
## # additional mcols(): taxonomyid, genome, description,
## #   coordinate_1_based, maintainer, rdatadateadded, preparerclass,
## #   tags, rdatapath, sourceurl, sourcetype 
## # retrieve records with, e.g., 'object[["AH47937"]]' 
## 
##             title                                   
##   AH47937 | Ailuropoda_melanoleuca.ailMel1.81.gtf   
##   AH47938 | Anas_platyrhynchos.BGI_duck_1.0.81.gtf  
##   AH47939 | Anolis_carolinensis.AnoCar2.0.81.gtf    
##   AH47940 | Astyanax_mexicanus.AstMex102.81.gtf     
##   AH47941 | Bos_taurus.UMD3.1.81.gtf                
##   ...       ...                                     
##   AH48001 | Tupaia_belangeri.TREESHREW.81.gtf       
##   AH48002 | Tursiops_truncatus.turTru1.81.gtf       
##   AH48003 | Vicugna_pacos.vicPac1.81.gtf            
##   AH48004 | Xenopus_tropicalis.JGI_4.2.81.gtf       
##   AH48005 | Xiphophorus_maculatus.Xipmac4.4.2.81.gtf
hub[["AH48004"]]
## loading from cache '/home/mtmorgan//.AnnotationHub/54310'
## using guess work to populate seqinfo
## GRanges object with 581787 ranges and 19 metadata columns:
##              seqnames       ranges strand |   source        type     score
##                 <Rle>    <IRanges>  <Rle> | <factor>    <factor> <numeric>
##        [1] GL172637.1   [ 34, 148]      - |  ensembl        gene      <NA>
##        [2] GL172637.1   [ 34, 148]      - |  ensembl  transcript      <NA>
##        [3] GL172637.1   [ 34, 148]      - |  ensembl        exon      <NA>
##        [4] GL172637.1   [606, 720]      - |  ensembl        gene      <NA>
##        [5] GL172637.1   [606, 720]      - |  ensembl  transcript      <NA>
##        ...        ...          ...    ... .      ...         ...       ...
##   [581783] GL180121.1 [ 865,  867]      + |  ensembl start_codon      <NA>
##   [581784] GL180121.1 [ 992, 1334]      + |  ensembl        exon      <NA>
##   [581785] GL180121.1 [ 992, 1334]      + |  ensembl         CDS      <NA>
##   [581786] GL180121.1 [1817, 1835]      + |  ensembl        exon      <NA>
##   [581787] GL180121.1 [1817, 1835]      + |  ensembl         CDS      <NA>
##                phase            gene_id gene_version   gene_name gene_source
##            <integer>        <character>    <numeric> <character> <character>
##        [1]      <NA> ENSXETG00000030486            1          U5     ensembl
##        [2]      <NA> ENSXETG00000030486            1          U5     ensembl
##        [3]      <NA> ENSXETG00000030486            1          U5     ensembl
##        [4]      <NA> ENSXETG00000031766            1          U5     ensembl
##        [5]      <NA> ENSXETG00000031766            1          U5     ensembl
##        ...       ...                ...          ...         ...         ...
##   [581783]         0 ENSXETG00000033193            1        <NA>     ensembl
##   [581784]      <NA> ENSXETG00000033193            1        <NA>     ensembl
##   [581785]         2 ENSXETG00000033193            1        <NA>     ensembl
##   [581786]      <NA> ENSXETG00000033193            1        <NA>     ensembl
##   [581787]         1 ENSXETG00000033193            1        <NA>     ensembl
##              gene_biotype      transcript_id transcript_version
##               <character>        <character>          <numeric>
##        [1]          snRNA               <NA>               <NA>
##        [2]          snRNA ENSXETT00000065882                  1
##        [3]          snRNA ENSXETT00000065882                  1
##        [4]          snRNA               <NA>               <NA>
##        [5]          snRNA ENSXETT00000061796                  1
##        ...            ...                ...                ...
##   [581783] protein_coding ENSXETT00000053735                  2
##   [581784] protein_coding ENSXETT00000053735                  2
##   [581785] protein_coding ENSXETT00000053735                  2
##   [581786] protein_coding ENSXETT00000053735                  2
##   [581787] protein_coding ENSXETT00000053735                  2
##            transcript_name transcript_source transcript_biotype exon_number
##                <character>       <character>        <character>   <numeric>
##        [1]            <NA>              <NA>               <NA>        <NA>
##        [2]          U5-201           ensembl              snRNA        <NA>
##        [3]          U5-201           ensembl              snRNA           1
##        [4]            <NA>              <NA>               <NA>        <NA>
##        [5]          U5-201           ensembl              snRNA        <NA>
##        ...             ...               ...                ...         ...
##   [581783]            <NA>           ensembl     protein_coding           1
##   [581784]            <NA>           ensembl     protein_coding           2
##   [581785]            <NA>           ensembl     protein_coding           2
##   [581786]            <NA>           ensembl     protein_coding           3
##   [581787]            <NA>           ensembl     protein_coding           3
##                       exon_id exon_version         protein_id
##                   <character>    <numeric>        <character>
##        [1]               <NA>         <NA>               <NA>
##        [2]               <NA>         <NA>               <NA>
##        [3] ENSXETE00000393193            1               <NA>
##        [4]               <NA>         <NA>               <NA>
##        [5]               <NA>         <NA>               <NA>
##        ...                ...          ...                ...
##   [581783]               <NA>         <NA>               <NA>
##   [581784] ENSXETE00000303775            2               <NA>
##   [581785]               <NA>         <NA> ENSXETP00000053735
##   [581786] ENSXETE00000416553            1               <NA>
##   [581787]               <NA>         <NA> ENSXETP00000053735
##            protein_version
##                  <numeric>
##        [1]            <NA>
##        [2]            <NA>
##        [3]            <NA>
##        [4]            <NA>
##        [5]            <NA>
##        ...             ...
##   [581783]            <NA>
##   [581784]            <NA>
##   [581785]               2
##   [581786]            <NA>
##   [581787]               2
##   -------
##   seqinfo: 2375 sequences from JGI_4 genome; no seqlengths

2 From files to Bioconductor objects

2.1 BED, GFF, GTF, WIG import and export

  • Genome annotations: BED, WIG, GTF, etc. files. E.g., GTF:

  • Component coordinates

    7   protein_coding  gene        27221129    27224842    .   -   . ...
    ...
    7   protein_coding  transcript  27221134    27224835    .   -   . ...
    7   protein_coding  exon        27224055    27224835    .   -   . ...
    7   protein_coding  CDS         27224055    27224763    .   -   0 ...
    7   protein_coding  start_codon 27224761    27224763    .   -   0 ...
    7   protein_coding  exon        27221134    27222647    .   -   . ...
    7   protein_coding  CDS         27222418    27222647    .   -   2 ...
    7   protein_coding  stop_codon  27222415    27222417    .   -   0 ...
    7   protein_coding  UTR         27224764    27224835    .   -   . ...
    7   protein_coding  UTR         27221134    27222414    .   -   . ...
  • Annotations

    gene_id "ENSG00000005073"; gene_name "HOXA11"; gene_source "ensembl_havana"; gene_biotype "protein_coding";
    ...
    ... transcript_id "ENST00000006015"; transcript_name "HOXA11-001"; transcript_source "ensembl_havana"; tag "CCDS"; ccds_id "CCDS5411";
    ... exon_number "1"; exon_id "ENSE00001147062";
    ... exon_number "1"; protein_id "ENSP00000006015";
    ... exon_number "1";
    ... exon_number "2"; exon_id "ENSE00002099557";
    ... exon_number "2"; protein_id "ENSP00000006015";
    ... exon_number "2";
    ...

2.1.1 The rtracklayer package

  • import(): import various formats to GRanges and similar instances
  • export(): transform from GRanges and similar types to BED, GTF, …
  • Also, functions to interactively drive UCSC genome browser with data from R / Bioconductor

2.2 FASTQ files

  • Sequenced reads: FASTQ files

    @ERR127302.1703 HWI-EAS350_0441:1:1:1460:19184#0/1
    CCTGAGTGAAGCTGATCTTGATCTACGAAGAGAGATAGATCTTGATCGTCGAGGAGATGCTGACCTTGACCT
    +
    HHGHHGHHHHHHHHDGG<GDGGE@GDGGD<?B8??ADAD<BE@EE8EGDGA3CB85*,77@>>CE?=896=:
    @ERR127302.1704 HWI-EAS350_0441:1:1:1460:16861#0/1
    GCGGTATGCTGGAAGGTGCTCGAATGGAGAGCGCCAGCGCCCCGGCGCTGAGCCGCAGCCTCAGGTCCGCCC
    +
    DE?DD>ED4>EEE>DE8EEEDE8B?EB<@3;BA79?,881B?@73;1?########################

2.2.1 The ShortRead package

  • readFastq(): input
  • FastqStreamer(): iterate through FASTQ files
  • FastqSampler(): sample from FASTQ files, e.g., for quality assessment
  • Functions for trimming and filters FASTQ files, QA assessment

2.3 Aligned reads

  • Aligned reads: BAM files

  • Header

    @HD     VN:1.0  SO:coordinate
    @SQ     SN:chr1 LN:249250621
    @SQ     SN:chr10        LN:135534747
    @SQ     SN:chr11        LN:135006516
    ...
    @SQ     SN:chrY LN:59373566
    @PG     ID:TopHat       VN:2.0.8b       CL:/home/hpages/tophat-2.0.8b.Linux_x86_64/tophat --mate-inner-dist 150 --solexa-quals --max-multihits 5 --no-discordant --no-mixed --coverage-search --microexon-search --library-type fr-unstranded --num-threads 2 --output-dir tophat2_out/ERR127306 /home/hpages/bowtie2-2.1.0/indexes/hg19 fastq/ERR127306_1.fastq fastq/ERR127306_2.fastq
  • Alignments: ID, flag, alignment and mate

    ERR127306.7941162       403     chr14   19653689        3       72M             =       19652348        -1413  ...
    ERR127306.22648137      145     chr14   19653692        1       72M             =       19650044        -3720  ...
    ERR127306.933914        339     chr14   19653707        1       66M120N6M       =       19653686        -213   ...
  • Alignments: sequence and quality

    ... GAATTGATCAGTCTCATCTGAGAGTAACTTTGTACCCATCACTGATTCCTTCTGAGACTGCCTCCACTTCCC        *'%%%%%#&&%''#'&%%%)&&%%$%%'%%'&*****$))$)'')'%)))&)%%%%$'%%%%&"))'')%))
    ... TTGATCAGTCTCATCTGAGAGTAACTTTGTACCCATCACTGATTCCTTCTGAGACTGCCTCCACTTCCCCAG        '**)****)*'*&*********('&)****&***(**')))())%)))&)))*')&***********)****
    ... TGAGAGTAACTTTGTACCCATCACTGATTCCTTCTGAGACTGCCTCCACTTCCCCAGCAGCCTCTGGTTTCT        '******&%)&)))&")')'')'*((******&)&'')'))$))'')&))$)**&&****************
  • Alignments: Tags

    ... AS:i:0  XN:i:0  XM:i:0  XO:i:0  XG:i:0  NM:i:0  MD:Z:72 YT:Z:UU NH:i:2  CC:Z:chr22      CP:i:16189276   HI:i:0
    ... AS:i:0  XN:i:0  XM:i:0  XO:i:0  XG:i:0  NM:i:0  MD:Z:72 YT:Z:UU NH:i:3  CC:Z:=  CP:i:19921600   HI:i:0
    ... AS:i:0  XN:i:0  XM:i:0  XO:i:0  XG:i:0  NM:i:4  MD:Z:72 YT:Z:UU XS:A:+  NH:i:3  CC:Z:=  CP:i:19921465   HI:i:0
    ... AS:i:0  XN:i:0  XM:i:0  XO:i:0  XG:i:0  NM:i:4  MD:Z:72 YT:Z:UU XS:A:+  NH:i:2  CC:Z:chr22      CP:i:16189138   HI:i:0

2.3.1 The GenomicAlignments package

  • readGAlignments(): Single-end reads
  • readGAlignmentPairs(), readGAlignmentsList(): paired end reads

2.3.2 Working with large files

  • ScanBamParam(): restrict input
  • BamFile(, yieldSize=): iteration
  • GenomicFiles provides useful helpers, e.g., reduceByYield()

2.4 Called variants: VCF files

  • Header

      ##fileformat=VCFv4.2
      ##fileDate=20090805
      ##source=myImputationProgramV3.1
      ##reference=file:///seq/references/1000GenomesPilot-NCBI36.fasta
      ##contig=<ID=20,length=62435964,assembly=B36,md5=f126cdf8a6e0c7f379d618ff66beb2da,species="Homo sapiens",taxonomy=x>
      ##phasing=partial
      ##INFO=<ID=DP,Number=1,Type=Integer,Description="Total Depth">
      ##INFO=<ID=AF,Number=A,Type=Float,Description="Allele Frequency">
      ...
      ##FILTER=<ID=q10,Description="Quality below 10">
      ##FILTER=<ID=s50,Description="Less than 50% of samples have data">
      ...
      ##FORMAT=<ID=GT,Number=1,Type=String,Description="Genotype">
      ##FORMAT=<ID=GQ,Number=1,Type=Integer,Description="Genotype Quality">
  • Location

      #CHROM POS     ID        REF    ALT     QUAL FILTER ...
      20     14370   rs6054257 G      A       29   PASS   ...
      20     17330   .         T      A       3    q10    ...
      20     1110696 rs6040355 A      G,T     67   PASS   ...
  • Variant INFO

      #CHROM POS     ...    INFO                              ...
      20     14370   ...    NS=3;DP=14;AF=0.5;DB;H2           ...
      20     17330   ...    NS=3;DP=11;AF=0.017               ...
      20     1110696 ...    NS=2;DP=10;AF=0.333,0.667;AA=T;DB ...
  • Genotype FORMAT and samples

      ... POS     ...  FORMAT      NA00001        NA00002        NA00003
      ... 14370   ...  GT:GQ:DP:HQ 0|0:48:1:51,51 1|0:48:8:51,51 1/1:43:5:.,.
      ... 17330   ...  GT:GQ:DP:HQ 0|0:49:3:58,50 0|1:3:5:65,3   0/0:41:3
      ... 1110696 ...  GT:GQ:DP:HQ 1|2:21:6:23,27 2|1:2:0:18,2   2/2:35:4

2.4.1 VariantAnnotation

  • readVcf(): VCF input
  • ScanVcfParam(): restrict input to necessary fields / ranges
  • VcfFile(): indexing and iterating through large VCF files
  • locateVariants(): annotate in relation to genes, etc; see also ensemblVEP, VariantFiltering
  • filterVcf(): flexible filtering

3 Exercises

3.1 GenomicAlignments

The RNAseqData.HNRNPC.bam.chr14 package is an example of an experiment data package. It contains a subset of BAM files used in a gene knock-down experiment, as described in ?RNAseqData.HNRNPC.bam.chr14. Load the package and get the path to the BAM files.

library(RNAseqData.HNRNPC.bam.chr14)
fls = RNAseqData.HNRNPC.bam.chr14_BAMFILES
basename(fls)
## [1] "ERR127306_chr14.bam" "ERR127307_chr14.bam" "ERR127308_chr14.bam"
## [4] "ERR127309_chr14.bam" "ERR127302_chr14.bam" "ERR127303_chr14.bam"
## [7] "ERR127304_chr14.bam" "ERR127305_chr14.bam"

Create BamFileList(), basically telling R that these are paths to BAM files rather than, say, text files from a spreadsheet.

library(GenomicAlignments)
bfls = BamFileList(fls)
bfl = bfls[[1]]

Input and explore the alignments. See ?readGAlignments and ?GAlignments for details on how to manipulate these objects.

ga = readGAlignments(bfl)
ga
## GAlignments object with 800484 alignments and 0 metadata columns:
##            seqnames strand       cigar    qwidth     start       end
##               <Rle>  <Rle> <character> <integer> <integer> <integer>
##        [1]    chr14      +         72M        72  19069583  19069654
##        [2]    chr14      +         72M        72  19363738  19363809
##        [3]    chr14      -         72M        72  19363755  19363826
##        [4]    chr14      +         72M        72  19369799  19369870
##        [5]    chr14      -         72M        72  19369828  19369899
##        ...      ...    ...         ...       ...       ...       ...
##   [800480]    chr14      -         72M        72 106989780 106989851
##   [800481]    chr14      +         72M        72 106994763 106994834
##   [800482]    chr14      -         72M        72 106994819 106994890
##   [800483]    chr14      +         72M        72 107003080 107003151
##   [800484]    chr14      -         72M        72 107003171 107003242
##                width     njunc
##            <integer> <integer>
##        [1]        72         0
##        [2]        72         0
##        [3]        72         0
##        [4]        72         0
##        [5]        72         0
##        ...       ...       ...
##   [800480]        72         0
##   [800481]        72         0
##   [800482]        72         0
##   [800483]        72         0
##   [800484]        72         0
##   -------
##   seqinfo: 93 sequences from an unspecified genome
table(strand(ga))
## 
##      +      -      * 
## 400242 400242      0

Many of the reads have cigar “72M”. What does this mean? Can you create a subset of reads that do not have this cigar? Interpret some of the non-72M cigars. Any hint about what these cigars represent?

tail(sort(table(cigar(ga))))
## 
## 18M123N54M 36M123N36M  64M316N8M 38M670N34M 35M123N37M        72M 
##        225        228        261        264        272     603939
ga[cigar(ga) != "72M"]
## GAlignments object with 196545 alignments and 0 metadata columns:
##            seqnames strand       cigar    qwidth     start       end
##               <Rle>  <Rle> <character> <integer> <integer> <integer>
##        [1]    chr14      -     64M1I7M        72  19411677  19411747
##        [2]    chr14      + 55M2117N17M        72  19650072  19652260
##        [3]    chr14      - 43M2117N29M        72  19650084  19652272
##        [4]    chr14      - 40M2117N32M        72  19650087  19652275
##        [5]    chr14      + 38M2117N34M        72  19650089  19652277
##        ...      ...    ...         ...       ...       ...       ...
##   [196541]    chr14      -    51M1D21M        72 106950429 106950501
##   [196542]    chr14      +    31M1I40M        72 106960410 106960480
##   [196543]    chr14      +    52M1D20M        72 106965156 106965228
##   [196544]    chr14      -    13M1D59M        72 106965195 106965267
##   [196545]    chr14      -     6M1D66M        72 106965202 106965274
##                width     njunc
##            <integer> <integer>
##        [1]        71         0
##        [2]      2189         1
##        [3]      2189         1
##        [4]      2189         1
##        [5]      2189         1
##        ...       ...       ...
##   [196541]        73         0
##   [196542]        71         0
##   [196543]        73         0
##   [196544]        73         0
##   [196545]        73         0
##   -------
##   seqinfo: 93 sequences from an unspecified genome

Use the function summarizeJunctions() to identify genomic regions that are spanned by reads with complicated cigars. Can you use the argument with.revmap=TRUE to extract the reads supporting a particular (e.g., first) junction?

summarizeJunctions(ga)
## GRanges object with 4635 ranges and 3 metadata columns:
##          seqnames                 ranges strand |     score plus_score
##             <Rle>              <IRanges>  <Rle> | <integer>  <integer>
##      [1]    chr14   [19650127, 19652243]      * |         4          2
##      [2]    chr14   [19650127, 19653624]      * |         1          1
##      [3]    chr14   [19652355, 19653624]      * |         8          7
##      [4]    chr14   [19652355, 19653657]      * |         1          1
##      [5]    chr14   [19653773, 19653892]      * |         9          5
##      ...      ...                    ...    ... .       ...        ...
##   [4631]    chr14 [106912703, 106922227]      * |         1          0
##   [4632]    chr14 [106938165, 106938301]      * |        10          2
##   [4633]    chr14 [106938645, 106944774]      * |        24          7
##   [4634]    chr14 [106944969, 106950170]      * |         7          6
##   [4635]    chr14 [106950323, 106960260]      * |         1          1
##          minus_score
##            <integer>
##      [1]           2
##      [2]           0
##      [3]           1
##      [4]           0
##      [5]           4
##      ...         ...
##   [4631]           1
##   [4632]           8
##   [4633]          17
##   [4634]           1
##   [4635]           0
##   -------
##   seqinfo: 93 sequences from an unspecified genome
junctions <- summarizeJunctions(ga, with.revmap=TRUE)
ga[ junctions$revmap[[1]] ]
## GAlignments object with 4 alignments and 0 metadata columns:
##       seqnames strand       cigar    qwidth     start       end     width
##          <Rle>  <Rle> <character> <integer> <integer> <integer> <integer>
##   [1]    chr14      + 55M2117N17M        72  19650072  19652260      2189
##   [2]    chr14      - 43M2117N29M        72  19650084  19652272      2189
##   [3]    chr14      - 40M2117N32M        72  19650087  19652275      2189
##   [4]    chr14      + 38M2117N34M        72  19650089  19652277      2189
##           njunc
##       <integer>
##   [1]         1
##   [2]         1
##   [3]         1
##   [4]         1
##   -------
##   seqinfo: 93 sequences from an unspecified genome

It is possible to do other actions on BAM files, e.g., calculating the ‘coverage’ (reads overlapping each base).

coverage(bfl)$chr14
## integer-Rle of length 107349540 with 493510 runs
##   Lengths: 19069582       72   294083 ...       19       72   346298
##   Values :        0        1        0 ...        0        1        0

3.2 SummarizedExperiment exercise

The airway experiment data package summarizes an RNA-seq experiment investigating human smooth-muscle airway cell lines treated with dexamethasone. Load the library and data set.

library(airway)
data(airway)
airway
## class: RangedSummarizedExperiment 
## dim: 64102 8 
## metadata(1): ''
## assays(1): counts
## rownames(64102): ENSG00000000003 ENSG00000000005 ... LRG_98 LRG_99
## rowData names(0):
## colnames(8): SRR1039508 SRR1039509 ... SRR1039520 SRR1039521
## colData names(9): SampleName cell ... Sample BioSample

airway is an example of the SummarizedExperiment class. Explore its assay() (the matrix of counts of reads overlapping genomic regions of interest in each sample), colData() (a description of each sample), and rowRanges() (a description of each region of interest; here each region is an ENSEMBL gene).

x <- assay(airway)
class(x)
## [1] "matrix"
dim(x)
## [1] 64102     8
head(x)
##                 SRR1039508 SRR1039509 SRR1039512 SRR1039513 SRR1039516
## ENSG00000000003        679        448        873        408       1138
## ENSG00000000005          0          0          0          0          0
## ENSG00000000419        467        515        621        365        587
## ENSG00000000457        260        211        263        164        245
## ENSG00000000460         60         55         40         35         78
## ENSG00000000938          0          0          2          0          1
##                 SRR1039517 SRR1039520 SRR1039521
## ENSG00000000003       1047        770        572
## ENSG00000000005          0          0          0
## ENSG00000000419        799        417        508
## ENSG00000000457        331        233        229
## ENSG00000000460         63         76         60
## ENSG00000000938          0          0          0
colData(airway)
## DataFrame with 8 rows and 9 columns
##            SampleName     cell      dex    albut        Run avgLength
##              <factor> <factor> <factor> <factor>   <factor> <integer>
## SRR1039508 GSM1275862   N61311    untrt    untrt SRR1039508       126
## SRR1039509 GSM1275863   N61311      trt    untrt SRR1039509       126
## SRR1039512 GSM1275866  N052611    untrt    untrt SRR1039512       126
## SRR1039513 GSM1275867  N052611      trt    untrt SRR1039513        87
## SRR1039516 GSM1275870  N080611    untrt    untrt SRR1039516       120
## SRR1039517 GSM1275871  N080611      trt    untrt SRR1039517       126
## SRR1039520 GSM1275874  N061011    untrt    untrt SRR1039520       101
## SRR1039521 GSM1275875  N061011      trt    untrt SRR1039521        98
##            Experiment    Sample    BioSample
##              <factor>  <factor>     <factor>
## SRR1039508  SRX384345 SRS508568 SAMN02422669
## SRR1039509  SRX384346 SRS508567 SAMN02422675
## SRR1039512  SRX384349 SRS508571 SAMN02422678
## SRR1039513  SRX384350 SRS508572 SAMN02422670
## SRR1039516  SRX384353 SRS508575 SAMN02422682
## SRR1039517  SRX384354 SRS508576 SAMN02422673
## SRR1039520  SRX384357 SRS508579 SAMN02422683
## SRR1039521  SRX384358 SRS508580 SAMN02422677
rowRanges(airway)
## GRangesList object of length 64102:
## $ENSG00000000003 
## GRanges object with 17 ranges and 2 metadata columns:
##        seqnames               ranges strand |   exon_id       exon_name
##           <Rle>            <IRanges>  <Rle> | <integer>     <character>
##    [1]        X [99883667, 99884983]      - |    667145 ENSE00001459322
##    [2]        X [99885756, 99885863]      - |    667146 ENSE00000868868
##    [3]        X [99887482, 99887565]      - |    667147 ENSE00000401072
##    [4]        X [99887538, 99887565]      - |    667148 ENSE00001849132
##    [5]        X [99888402, 99888536]      - |    667149 ENSE00003554016
##    ...      ...                  ...    ... .       ...             ...
##   [13]        X [99890555, 99890743]      - |    667156 ENSE00003512331
##   [14]        X [99891188, 99891686]      - |    667158 ENSE00001886883
##   [15]        X [99891605, 99891803]      - |    667159 ENSE00001855382
##   [16]        X [99891790, 99892101]      - |    667160 ENSE00001863395
##   [17]        X [99894942, 99894988]      - |    667161 ENSE00001828996
## 
## ...
## <64101 more elements>
## -------
## seqinfo: 722 sequences (1 circular) from an unspecified genome

It’s easy to subset a SummarizedExperiment on rows, columns and assays, e.g., retaining just those samples in the trt level of the dex factor. Accessing elements of the column data is common, so there is a short-cut.

cidx <- colData(airway)$dex %in% "trt"
airway[, cidx]
## class: RangedSummarizedExperiment 
## dim: 64102 4 
## metadata(1): ''
## assays(1): counts
## rownames(64102): ENSG00000000003 ENSG00000000005 ... LRG_98 LRG_99
## rowData names(0):
## colnames(4): SRR1039509 SRR1039513 SRR1039517 SRR1039521
## colData names(9): SampleName cell ... Sample BioSample
## shortcut
airway[, airway$dex %in% "trt"]
## class: RangedSummarizedExperiment 
## dim: 64102 4 
## metadata(1): ''
## assays(1): counts
## rownames(64102): ENSG00000000003 ENSG00000000005 ... LRG_98 LRG_99
## rowData names(0):
## colnames(4): SRR1039509 SRR1039513 SRR1039517 SRR1039521
## colData names(9): SampleName cell ... Sample BioSample

It’s also easy to perform range-based operations on SummarizedExperiment objects, e.g., querying for range of chromosome 14 and then subsetting to contain only genes on this chromosome. Range operations on rows are very common, so there are shortcuts here, too.

chr14 <- as(seqinfo(rowRanges(airway)), "GRanges")["14"]
ridx <- rowRanges(airway) %over% chr14
airway[ridx,]
## class: RangedSummarizedExperiment 
## dim: 2244 8 
## metadata(1): ''
## assays(1): counts
## rownames(2244): ENSG00000006432 ENSG00000009830 ... ENSG00000273259
##   ENSG00000273307
## rowData names(0):
## colnames(8): SRR1039508 SRR1039509 ... SRR1039520 SRR1039521
## colData names(9): SampleName cell ... Sample BioSample
## shortcut
chr14 <- as(seqinfo(airway), "GRanges")["14"]
airway[airway %over% chr14,]
## class: RangedSummarizedExperiment 
## dim: 2244 8 
## metadata(1): ''
## assays(1): counts
## rownames(2244): ENSG00000006432 ENSG00000009830 ... ENSG00000273259
##   ENSG00000273307
## rowData names(0):
## colnames(8): SRR1039508 SRR1039509 ... SRR1039520 SRR1039521
## colData names(9): SampleName cell ... Sample BioSample

Use the assay() and rowSums() function to remove all rows from the airway object that have 0 reads overlapping all samples. Summarize the library size (column sums of assay()) and plot a histogram of the distribution of reads per feature of interest.

3.3 Annotation and GenomicFeatures

Load the org package for Homo sapiens.

library(org.Hs.eg.db)

Use select() to annotate the HNRNPC gene symbol with its Entrez identifier and less formal gene name. Create a map between SYMBOL and ENTREZID using mapIds().

select(org.Hs.eg.db, "HNRNPC", c("ENTREZID", "GENENAME"), "SYMBOL")
## 'select()' returned 1:1 mapping between keys and columns
##   SYMBOL ENTREZID                                          GENENAME
## 1 HNRNPC     3183 heterogeneous nuclear ribonucleoprotein C (C1/C2)
sym2eg <- mapIds(org.Hs.eg.db, "HNRNPC", "ENTREZID", "SYMBOL")
## 'select()' returned 1:1 mapping between keys and columns

Load the TxDb package for the UCSC hg19 knownGene track

library(TxDb.Hsapiens.UCSC.hg19.knownGene)
txdb <- TxDb.Hsapiens.UCSC.hg19.knownGene

Extract coordinates of genes, and of exons grouped by gene for the HNRNPC gene.

gns <- genes(txdb)
exonsBy(txdb, "gene")[sym2eg]
## GRangesList object of length 1:
## $3183 
## GRanges object with 19 ranges and 2 metadata columns:
##        seqnames               ranges strand |   exon_id   exon_name
##           <Rle>            <IRanges>  <Rle> | <integer> <character>
##    [1]    chr14 [21677296, 21679465]      - |    184100        <NA>
##    [2]    chr14 [21678927, 21679725]      - |    184101        <NA>
##    [3]    chr14 [21679565, 21679672]      - |    184102        <NA>
##    [4]    chr14 [21679565, 21679725]      - |    184103        <NA>
##    [5]    chr14 [21679969, 21680062]      - |    184104        <NA>
##    ...      ...                  ...    ... .       ...         ...
##   [15]    chr14 [21702237, 21702388]      - |    184114        <NA>
##   [16]    chr14 [21730760, 21730927]      - |    184115        <NA>
##   [17]    chr14 [21731470, 21731495]      - |    184116        <NA>
##   [18]    chr14 [21731826, 21731988]      - |    184117        <NA>
##   [19]    chr14 [21737457, 21737638]      - |    184118        <NA>
## 
## -------
## seqinfo: 93 sequences (1 circular) from hg19 genome

Use the gene coordinates to query the BAM file for a specific genomic region; see ?ScanBamParam() for other ways of restricting data input.

library(Rsamtools)
param <- ScanBamParam(which=gns[sym2eg])
readGAlignments(bfl, param=param)
## GAlignments object with 5422 alignments and 0 metadata columns:
##          seqnames strand       cigar    qwidth     start       end     width
##             <Rle>  <Rle> <character> <integer> <integer> <integer> <integer>
##      [1]    chr14      +         72M        72  21677347  21677418        72
##      [2]    chr14      +         72M        72  21677352  21677423        72
##      [3]    chr14      +         72M        72  21677354  21677425        72
##      [4]    chr14      +         72M        72  21677355  21677426        72
##      [5]    chr14      +         72M        72  21677373  21677444        72
##      ...      ...    ...         ...       ...       ...       ...       ...
##   [5418]    chr14      -         72M        72  21737512  21737583        72
##   [5419]    chr14      -         72M        72  21737520  21737591        72
##   [5420]    chr14      -         72M        72  21737520  21737591        72
##   [5421]    chr14      -         72M        72  21737521  21737592        72
##   [5422]    chr14      -         72M        72  21737534  21737605        72
##              njunc
##          <integer>
##      [1]         0
##      [2]         0
##      [3]         0
##      [4]         0
##      [5]         0
##      ...       ...
##   [5418]         0
##   [5419]         0
##   [5420]         0
##   [5421]         0
##   [5422]         0
##   -------
##   seqinfo: 93 sequences from an unspecified genome

3.4 AnnotationHub

The Roadmap Epigenomics Project generated genome-wide maps of regulatory marks across a number of cell lines.

Retrieve the Epigenome Roadmap table from AnnotationHub…

library(AnnotationHub)
hub <- AnnotationHub()
## snapshotDate(): 2017-04-25
query(hub, c("epigenome", "metadata"))
## AnnotationHub with 1 record
## # snapshotDate(): 2017-04-25 
## # names(): AH41830
## # $dataprovider: BroadInstitute
## # $species: Homo sapiens
## # $rdataclass: data.frame
## # $rdatadateadded: 2015-05-11
## # $title: EID_metadata.tab
## # $description: Metadata for EpigenomeRoadMap Project
## # $taxonomyid: 9606
## # $genome: hg19
## # $sourcetype: tab
## # $sourceurl: http://egg2.wustl.edu/roadmap/data/byFileType/metadata/EID_...
## # $sourcesize: 18035
## # $tags: c("EpigenomeRoadMap", "Metadata") 
## # retrieve record with 'object[["AH41830"]]'
meta <- hub[["AH41830"]]
## loading from cache '/home/mtmorgan//.AnnotationHub/47270'

Explore the metadata to identify a cell line of interest to you; see also the metadata spreadsheet version of the data made available by the Epigenome roadmap project.

table(meta$ANATOMY)
## 
##            ADRENAL              BLOOD               BONE              BRAIN 
##                  1                 27                  1                 13 
##             BREAST             CERVIX                ESC        ESC_DERIVED 
##                  3                  1                  8                  9 
##                FAT           GI_COLON        GI_DUODENUM       GI_ESOPHAGUS 
##                  3                  3                  2                  1 
##       GI_INTESTINE          GI_RECTUM         GI_STOMACH              HEART 
##                  3                  3                  4                  4 
##               IPSC             KIDNEY              LIVER               LUNG 
##                  5                  1                  2                  5 
##             MUSCLE         MUSCLE_LEG              OVARY           PANCREAS 
##                  7                  1                  1                  2 
##           PLACENTA               SKIN             SPLEEN STROMAL_CONNECTIVE 
##                  2                  8                  1                  2 
##             THYMUS           VASCULAR 
##                  2                  2
meta[meta$ANATOMY == "LIVER",]
##      EID      GROUP   COLOR       MNEMONIC
## 64  E066      Other #999999       LIV.ADLT
## 116 E118 ENCODE2012 #000000 LIV.HEPG2.CNCR
##                                     STD_NAME                     EDACC_NAME
## 64                                     Liver                    Adult_Liver
## 116 HepG2 Hepatocellular Carcinoma Cell Line HepG2_Hepatocellular_Carcinoma
##     ANATOMY          TYPE     AGE   SEX SOLID_LIQUID ETHNICITY
## 64    LIVER PrimaryTissue Unknown Mixed        SOLID   Unknown
## 116   LIVER      CellLine          Male                       
##     SINGLEDONOR_COMPOSITE
## 64                      C
## 116                    SD

Use the ‘EID’ to query for and retrieve the ‘mnemonic’ file summarizing chromatin state

query(hub, c("E118", "mnemonic"))
## AnnotationHub with 1 record
## # snapshotDate(): 2017-04-25 
## # names(): AH46971
## # $dataprovider: BroadInstitute
## # $species: Homo sapiens
## # $rdataclass: GRanges
## # $rdatadateadded: 2015-05-14
## # $title: E118_15_coreMarks_mnemonics.bed.gz
## # $description: 15 state chromatin segmentations from EpigenomeRoadMap Pr...
## # $taxonomyid: 9606
## # $genome: hg19
## # $sourcetype: BED
## # $sourceurl: http://egg2.wustl.edu/roadmap/data/byFileType/chromhmmSegme...
## # $sourcesize: 3231313
## # $tags: c("EpigenomeRoadMap", "chromhmmSegmentations",
## #   "ChmmModels", "coreMarks", "E118", "ENCODE2012", "LIV.HEPG2.CNCR",
## #   "HepG2 Hepatocellular Carcinoma Cell Line") 
## # retrieve record with 'object[["AH46971"]]'
E118 <- hub[["AH46971"]]
## require("rtracklayer")
## loading from cache '/home/mtmorgan//.AnnotationHub/52411'
E118
## GRanges object with 561497 ranges and 4 metadata columns:
##            seqnames               ranges strand |        abbr
##               <Rle>            <IRanges>  <Rle> | <character>
##        [1]    chr10     [     1, 113200]      * |    15_Quies
##        [2]    chr10     [113201, 119600]      * | 14_ReprPCWk
##        [3]    chr10     [119601, 120000]      * |   10_TssBiv
##        [4]    chr10     [120001, 120200]      * |      1_TssA
##        [5]    chr10     [120201, 120400]      * |  2_TssAFlnk
##        ...      ...                  ...    ... .         ...
##   [561493]     chrY [58907201, 58967400]      * |    15_Quies
##   [561494]     chrY [58967401, 58972000]      * |       9_Het
##   [561495]     chrY [58972001, 58997400]      * |  8_ZNF/Rpts
##   [561496]     chrY [58997401, 59033600]      * |       9_Het
##   [561497]     chrY [59033601, 59373400]      * |    15_Quies
##                               name        color_name  color_code
##                        <character>       <character> <character>
##        [1]           Quiescent/Low             White     #FFFFFF
##        [2] Weak Repressed PolyComb         Gainsboro     #C0C0C0
##        [3]     Bivalent/Poised TSS         IndianRed     #CD5C5C
##        [4]              Active TSS               Red     #FF0000
##        [5]     Flanking Active TSS        Orange Red     #FF4500
##        ...                     ...               ...         ...
##   [561493]           Quiescent/Low             White     #FFFFFF
##   [561494]         Heterochromatin     PaleTurquoise     #8A91D0
##   [561495]     ZNF genes & repeats Medium Aquamarine     #66CDAA
##   [561496]         Heterochromatin     PaleTurquoise     #8A91D0
##   [561497]           Quiescent/Low             White     #FFFFFF
##   -------
##   seqinfo: 93 sequences (1 circular) from hg19 genome

Explore the object, e.g., tabulating the different chromatin state classifications (in the name column). Subset the object to return, e.g., just those regions marked as ‘Heterochromatin’

table(E118$name)
## 
##                 Active TSS          Bivalent Enhancer 
##                      20010                      23155 
##        Bivalent/Poised TSS                  Enhancers 
##                      13214                     110260 
##        Flanking Active TSS  Flanking Bivalent TSS/Enh 
##                      45115                      15844 
##            Genic enhancers            Heterochromatin 
##                      14995                      31193 
##              Quiescent/Low         Repressed PolyComb 
##                      61759                      44013 
##       Strong transcription Transcr. at gene 5' and 3' 
##                      32522                       2515 
##    Weak Repressed PolyComb         Weak transcription 
##                      60867                      83738 
##        ZNF genes & repeats 
##                       2297
E118[E118$name %in% "Heterochromatin"]
## GRanges object with 31193 ranges and 4 metadata columns:
##           seqnames               ranges strand |        abbr            name
##              <Rle>            <IRanges>  <Rle> | <character>     <character>
##       [1]    chr10   [ 140201,  143800]      * |       9_Het Heterochromatin
##       [2]    chr10   [ 806201,  807800]      * |       9_Het Heterochromatin
##       [3]    chr10   [ 842001,  843800]      * |       9_Het Heterochromatin
##       [4]    chr10   [1024601, 1027200]      * |       9_Het Heterochromatin
##       [5]    chr10   [1191601, 1192600]      * |       9_Het Heterochromatin
##       ...      ...                  ...    ... .         ...             ...
##   [31189]     chrY [58883001, 58885400]      * |       9_Het Heterochromatin
##   [31190]     chrY [58890001, 58891000]      * |       9_Het Heterochromatin
##   [31191]     chrY [58906401, 58907200]      * |       9_Het Heterochromatin
##   [31192]     chrY [58967401, 58972000]      * |       9_Het Heterochromatin
##   [31193]     chrY [58997401, 59033600]      * |       9_Het Heterochromatin
##              color_name  color_code
##             <character> <character>
##       [1] PaleTurquoise     #8A91D0
##       [2] PaleTurquoise     #8A91D0
##       [3] PaleTurquoise     #8A91D0
##       [4] PaleTurquoise     #8A91D0
##       [5] PaleTurquoise     #8A91D0
##       ...           ...         ...
##   [31189] PaleTurquoise     #8A91D0
##   [31190] PaleTurquoise     #8A91D0
##   [31191] PaleTurquoise     #8A91D0
##   [31192] PaleTurquoise     #8A91D0
##   [31193] PaleTurquoise     #8A91D0
##   -------
##   seqinfo: 93 sequences (1 circular) from hg19 genome

Can you, using a TxDb package and the genes() and subsetByOverlaps() functions, determine how many genes overlap heterochromatic states, or the genes nearest() each enhancer?

3.5 biomaRt

Visit the biomart website and figure out how to browse data to retrieve, e.g., genes on chromosomes 21 and 22. You’ll need to browse to the ensembl mart, Homo spaiens data set, establish filters for chromosomes 21 and 22, and then specify that you’d like the Ensembl gene id attribute returned.

Now do the same process in biomaRt:

library(biomaRt)
head(listMarts(), 3)                      ## list marts
head(listDatasets(useMart("ensembl")), 3) ## mart datasets
ensembl <-                                ## fully specified mart
    useMart("ensembl", dataset = "hsapiens_gene_ensembl")

head(listFilters(ensembl), 3)             ## filters
myFilter <- "chromosome_name"
substr(filterOptions(myFilter, ensembl), 1, 50) ## return values
myValues <- c("21", "22")
head(listAttributes(ensembl), 3)          ## attributes
myAttributes <- c("ensembl_gene_id","chromosome_name")

## assemble and query the mart
res <- getBM(attributes =  myAttributes, filters =  myFilter,
             values =  myValues, mart = ensembl)