miRBaseVersions.db-vignette

1. Introduction
- Vignette Info
- Database information
2. Use Cases
Additional information
- Packages loaded via namespace
- Future Aspects
References

The miRBase database (Griffiths-Jones, 2004; Griffiths-Jones, Grocock, Dongen, Bateman, & Enright, 2006; Griffiths-Jones, Saini, Dongen, & Enright, 2008; Kozomara & Griffiths-Jones, 2011, 2014) is the official repository for miRNAs and includes a miRNA naming convention (AMBROS et al., 2003; Meyers et al., 2008). Over the years of development miRNAs have been added to, or deleted from the database, while some miRNA names have been changed. As a result, each version of the miRBase database can differ substantially from previous versions.

The miRBaseVersions.db R package has been developed to provide an easy accessible repository for several different miRBase release versions.

1. Introduction

The miRBaseVersions.db package is an annotation package which includes mature miRNA names from 22 miRBase release versions. Due to ongoing growth and changes with each release miRNA names can have different names in different versions or even are not listed as valid miRNAs anymore. This annotation package serves as a repository and can be used for quick lookup for mature miRNA names. The miRBaseVersions.db package has implemented the AnnotationDbi-select interface. By implementing this select interface the user is able to use the same methods as for any other annotation package.

The main four implemented methods are

columns, presents the values one can retrieve in the final result,
keytypes, which presents the tables that can be used in this package,
keys, is used to get viable keys of a particular keytype and
select, which is used to extract data from the annotation package by using values provided by the other three methods.

To load the package and gain access to the functions just run the following command:

library(miRBaseVersions.db)

Vignette Info

This vignette has been generated using an R Markdown file with knitr:rmarkdown as vignette engine (Boettiger, 2015; Francois, 2014; Xie, 2014, 2015b, 2015a).

Database information

The data is the miRNAmeConverter package is stored in an SQLite database. All entries contained in the database were downloaded from the miRBase ftp-site. The following versions are available:

miRBase Version	Release Date	# Mature entries
6.0	04/05	1650
7.1	10/05	3424
8.0	02/06	3518
8.1	05/06	3963
8.2	07/06	4039
9.0	10/06	4361
9.1	02/07	4449
9.2	05/07	4584
10.0	08/07	5071
10.1	12/07	5395
11.0	04/08	6396
12.0	09/08	8619
13.0	03/09	9539
14.0	09/09	10883
15.0	04/10	14197
16.0	08/10	15172
17.0	04/11	16772
18.0	11/11	18226
19.0	08/12	21264
20.0	06/13	24521
21.0	06/14	28645
22.0	03/18	38589

from 271 organisms.

2. Use Cases

2.1 Function `keytypes`

Use this function to receive table names from where data can be retrieved:

keytypes(miRBaseVersions.db);

##  [1] "MIMAT"         "VW-MIMAT-10.0" "VW-MIMAT-10.1" "VW-MIMAT-11.0"
##  [5] "VW-MIMAT-12.0" "VW-MIMAT-13.0" "VW-MIMAT-14.0" "VW-MIMAT-15.0"
##  [9] "VW-MIMAT-16.0" "VW-MIMAT-17.0" "VW-MIMAT-18.0" "VW-MIMAT-19.0"
## [13] "VW-MIMAT-20.0" "VW-MIMAT-21.0" "VW-MIMAT-22.0" "VW-MIMAT-6.0" 
## [17] "VW-MIMAT-7.1"  "VW-MIMAT-8.0"  "VW-MIMAT-8.1"  "VW-MIMAT-8.2" 
## [21] "VW-MIMAT-9.0"  "VW-MIMAT-9.1"  "VW-MIMAT-9.2"

The output lists 23 tables where each one of them can be queried. The keytype “MIMAT” is the main table containing all records from all supported miRBase release versions. Keytypes starting with the prefix “VW-MIMAT” are so called SQL views. For example the keytype “VW-MIMAT-22.0” is an SQL view from the “MIMAT” table which only holds records from miRBase version 22.0.

2.2 Function `columns`

Use the columns function to retreive information about the kind of variables you can retrieve in the final output:

columns(miRBaseVersions.db);

## [1] "ACCESSION" "NAME"      "ORGANISM"  "SEQUENCE"  "VERSION"

All 5 columns are available for all 23 keytypes.

2.3 Function `keys`

The keys function returns all viable keys of a praticular keytype. The following example retrieves all possible keys for miRBase release version 6.0.

k = head(keys(miRBaseVersions.db, keytype = "VW-MIMAT-6.0"));
k;

## [1] "MIMAT0000001" "MIMAT0000002" "MIMAT0000003" "MIMAT0000004"
## [5] "MIMAT0000005" "MIMAT0000006"

2.4 Function `select`

The select function is used to extract data. As input values the function takes outputs received from the other three functions keys, columns and keytypes.
For exmaple to extract all information about the mature accession ‘MIMAT0000092’ we can run the following command:

result = select(miRBaseVersions.db, 
                keys = "MIMAT0000092", 
                keytype = "MIMAT", 
                columns = "*")
result;

##       ACCESSION           NAME               SEQUENCE VERSION ORGANISM
## 1  MIMAT0000092 hsa-miR-92a-3p UAUUGCACUUGUCCCGGCCUGU    22.0      hsa
## 2  MIMAT0000092 hsa-miR-92a-3p UAUUGCACUUGUCCCGGCCUGU    21.0      hsa
## 3  MIMAT0000092 hsa-miR-92a-3p UAUUGCACUUGUCCCGGCCUGU    20.0      hsa
## 4  MIMAT0000092 hsa-miR-92a-3p UAUUGCACUUGUCCCGGCCUGU    19.0      hsa
## 5  MIMAT0000092 hsa-miR-92a-3p UAUUGCACUUGUCCCGGCCUGU    18.0      hsa
## 6  MIMAT0000092    hsa-miR-92a UAUUGCACUUGUCCCGGCCUGU    17.0      hsa
## 7  MIMAT0000092    hsa-miR-92a UAUUGCACUUGUCCCGGCCUGU    16.0      hsa
## 8  MIMAT0000092    hsa-miR-92a UAUUGCACUUGUCCCGGCCUGU    15.0      hsa
## 9  MIMAT0000092    hsa-miR-92a UAUUGCACUUGUCCCGGCCUGU    14.0      hsa
## 10 MIMAT0000092    hsa-miR-92a UAUUGCACUUGUCCCGGCCUGU    13.0      hsa
## 11 MIMAT0000092    hsa-miR-92a UAUUGCACUUGUCCCGGCCUGU    12.0      hsa
## 12 MIMAT0000092    hsa-miR-92a UAUUGCACUUGUCCCGGCCUGU    11.0      hsa
## 13 MIMAT0000092    hsa-miR-92a UAUUGCACUUGUCCCGGCCUGU    10.1      hsa
## 14 MIMAT0000092    hsa-miR-92a UAUUGCACUUGUCCCGGCCUGU    10.0      hsa
## 15 MIMAT0000092     hsa-miR-92  UAUUGCACUUGUCCCGGCCUG     9.2      hsa
## 16 MIMAT0000092     hsa-miR-92  UAUUGCACUUGUCCCGGCCUG     9.1      hsa
## 17 MIMAT0000092     hsa-miR-92  UAUUGCACUUGUCCCGGCCUG     9.0      hsa
## 18 MIMAT0000092     hsa-miR-92  UAUUGCACUUGUCCCGGCCUG     8.2      hsa
## 19 MIMAT0000092     hsa-miR-92  UAUUGCACUUGUCCCGGCCUG     8.1      hsa
## 20 MIMAT0000092     hsa-miR-92  UAUUGCACUUGUCCCGGCCUG     8.0      hsa
## 21 MIMAT0000092     hsa-miR-92  UAUUGCACUUGUCCCGGCCUG     7.1      hsa
## 22 MIMAT0000092     hsa-miR-92  UAUUGCACUUGUCCCGGCCUG     6.0      hsa

As we can see the result returns all miRNA names the accession had among the different miRBase releases. If we for example only want to extract the fields for ‘accession’, ‘name’ and ‘version’ we simply run the following command:

result = select(miRBaseVersions.db, 
                keys = "MIMAT0000092", 
                keytype = "MIMAT", 
                columns = c("ACCESSION", "NAME", "VERSION"))
result;

##       ACCESSION           NAME VERSION
## 1  MIMAT0000092 hsa-miR-92a-3p    22.0
## 2  MIMAT0000092 hsa-miR-92a-3p    21.0
## 3  MIMAT0000092 hsa-miR-92a-3p    20.0
## 4  MIMAT0000092 hsa-miR-92a-3p    19.0
## 5  MIMAT0000092 hsa-miR-92a-3p    18.0
## 6  MIMAT0000092    hsa-miR-92a    17.0
## 7  MIMAT0000092    hsa-miR-92a    16.0
## 8  MIMAT0000092    hsa-miR-92a    15.0
## 9  MIMAT0000092    hsa-miR-92a    14.0
## 10 MIMAT0000092    hsa-miR-92a    13.0
## 11 MIMAT0000092    hsa-miR-92a    12.0
## 12 MIMAT0000092    hsa-miR-92a    11.0
## 13 MIMAT0000092    hsa-miR-92a    10.1
## 14 MIMAT0000092    hsa-miR-92a    10.0
## 15 MIMAT0000092     hsa-miR-92     9.2
## 16 MIMAT0000092     hsa-miR-92     9.1
## 17 MIMAT0000092     hsa-miR-92     9.0
## 18 MIMAT0000092     hsa-miR-92     8.2
## 19 MIMAT0000092     hsa-miR-92     8.1
## 20 MIMAT0000092     hsa-miR-92     8.0
## 21 MIMAT0000092     hsa-miR-92     7.1
## 22 MIMAT0000092     hsa-miR-92     6.0

In comparison to the previous output with parameter columns = "*" this time only the selected columns were returned.

Additional information

Packages loaded via namespace

The following packages are used in the miRBaseVersions.db package:

AnnotationDbi_1.32.3 (Pages, Carlson, Falcon, & Li, n.d.)
DBI_0.3.1 (Databases, 2014)
RSQLite_1.0.0 (Wickham, James, & Falcon, 2014)
gtools_3.5.0 (Warnes, Bolker, & Lumley, 2015)

Future Aspects

This database can only be of good use if it will be kept up to date. Therefore we plan to include new miRBase releases as soon as possible.

References

AMBROS, V., BARTEL, B., BARTEL, D. P., BURGE, C. B., CARRINGTON, J. C., CHEN, X., … TUSCHL, T. (2003). A uniform system for microRNA annotation. RNA, 9(3), 277–279. http://doi.org/10.1261/rna.2183803

Boettiger, C. (2015). Knitcitations: Citations for ’knitr’ markdown files. Retrieved from http://CRAN.R-project.org/package=knitcitations

Databases, R. S. I. G. on. (2014). DBI: R database interface. Retrieved from http://CRAN.R-project.org/package=DBI

Francois, R. (2014). Bibtex: Bibtex parser. Retrieved from http://CRAN.R-project.org/package=bibtex

Griffiths-Jones, S. (2004). The microRNA registry. Nucleic Acids Research, 32(suppl 1), D109–D111. http://doi.org/10.1093/nar/gkh023

Griffiths-Jones, S., Grocock, R. J., Dongen, S. van, Bateman, A., & Enright, A. J. (2006). MiRBase: MicroRNA sequences, targets and gene nomenclature. Nucleic Acids Research, 34(suppl 1), D140–D144. http://doi.org/10.1093/nar/gkj112

Griffiths-Jones, S., Saini, H. K., Dongen, S. van, & Enright, A. J. (2008). MiRBase: Tools for microRNA genomics. Nucleic Acids Research, 36(suppl 1), D154–D158. http://doi.org/10.1093/nar/gkm952

Kozomara, A., & Griffiths-Jones, S. (2011). MiRBase: Integrating microRNA annotation and deep-sequencing data. Nucleic Acids Research, 39(suppl 1), D152–D157. http://doi.org/10.1093/nar/gkq1027

Kozomara, A., & Griffiths-Jones, S. (2014). MiRBase: Annotating high confidence microRNAs using deep sequencing data. Nucleic Acids Research, 42(D1), D68–D73. http://doi.org/10.1093/nar/gkt1181

Meyers, B. C., Axtell, M. J., Bartel, B., Bartel, D. P., Baulcombe, D., Bowman, J. L., … others. (2008). Criteria for annotation of plant micrornas. The Plant Cell, 20(12), 3186–3190.

Pages, H., Carlson, M., Falcon, S., & Li, N. (n.d.). AnnotationDbi: Annotation database interface.

Warnes, G. R., Bolker, B., & Lumley, T. (2015). Gtools: Various r programming tools. Retrieved from https://CRAN.R-project.org/package=gtools

Wickham, H., James, D. A., & Falcon, S. (2014). RSQLite: SQLite interface for r. Retrieved from http://CRAN.R-project.org/package=RSQLite

Xie, Y. (2014). Knitr: A comprehensive tool for reproducible research in R. In V. Stodden, F. Leisch, & R. D. Peng (Eds.), Implementing reproducible computational research. Chapman; Hall/CRC. Retrieved from http://www.crcpress.com/product/isbn/9781466561595

Xie, Y. (2015a). Dynamic documents with R and knitr (2nd ed.). Boca Raton, Florida: Chapman; Hall/CRC. Retrieved from http://yihui.name/knitr/

Xie, Y. (2015b). Knitr: A general-purpose package for dynamic report generation in r. Retrieved from http://yihui.name/knitr/

miRBaseVersions.db-vignette

Stefan Haunsberger

2018-03-26

1. Introduction

Vignette Info

Database information

2. Use Cases

2.1 Function `keytypes`

2.2 Function `columns`

2.3 Function `keys`

2.4 Function `select`

Additional information

Packages loaded via namespace

Future Aspects

References

miRBaseVersions.db-vignette

Stefan Haunsberger

2018-03-26

1. Introduction

Vignette Info

Database information

2. Use Cases

2.1 Function keytypes

2.2 Function columns

2.3 Function keys

2.4 Function select

Additional information

Packages loaded via namespace

Future Aspects

References

2.1 Function `keytypes`

2.2 Function `columns`

2.3 Function `keys`

2.4 Function `select`