Contents

1 Core infrastructure

1.1 S4 Objects

Why?

  • Interoperability
  • Robustness

What?

  • Interface (what you want to know about) and implementation (what you don’t want to know about!)
library(Biostrings)
head( methods(class = "DNAStringSet") )
## [1] "!,List-method"           "!=,ANY,Vector-method"   
## [3] "!=,Vector,ANY-method"    "!=,Vector,Vector-method"
## [5] "[,List-method"           "[[,List-method"
methods(generic = "reverseComplement")
##  [1] reverseComplement,DNAString-method                
##  [2] reverseComplement,DNAStringSet-method             
##  [3] reverseComplement,MaskedDNAString-method          
##  [4] reverseComplement,MaskedRNAString-method          
##  [5] reverseComplement,matrix-method                   
##  [6] reverseComplement,QualityScaledDNAStringSet-method
##  [7] reverseComplement,QualityScaledRNAStringSet-method
##  [8] reverseComplement,RNAString-method                
##  [9] reverseComplement,RNAStringSet-method             
## [10] reverseComplement,XStringViews-method             
## see '?methods' for accessing help and source code
  • Caveats

1.2 Biostrings

DNA, amino acid, and other biological sequences. See earlier example in 01: Introdction to R and Bioconductor.

1.3 GRanges

1.3.1 The GenomicRanges package

  • GRanges(): genomic coordinates to represent annotations (exons, genes, regulatory marks, …) and data (called peaks, variants, aligned reads)
Alt GRanges

Alt GRanges

  • GRangesList(): genomic coordinates grouped into list elements (e.g., paired-end reads; exons grouped by transcript)
Alt GRangesList

Alt GRangesList

1.3.2 Range operations

Alt Ranges Algebra

Alt Ranges Algebra

1.3.2.1 Ranges

  • IRanges
    • start() / end() / width()
    • List-like – length(), subset, etc.
    • ‘metadata’, mcols()
  • GRanges
    • ‘seqnames’ (chromosome), ‘strand’
    • Seqinfo, including seqlevels and seqlengths

1.3.2.2 Intra-range methods

  • Independent of other ranges in the same object
  • GRanges variants strand-aware
  • shift(), narrow(), flank(), promoters(), resize(), restrict(), trim()
  • See ?"intra-range-methods"

1.3.2.3 Inter-range methods

  • Depends on other ranges in the same object
  • range(), reduce(), gaps(), disjoin()
  • coverage() (!)
  • see ?"inter-range-methods"

1.3.2.4 Between-range methods

  • Functions of two (or more) range objects
  • findOverlaps(), countOverlaps(), …, %over%, %within%, %outside%; union(), intersect(), setdiff(), punion(), pintersect(), psetdiff()

1.3.2.5 Example

library(GenomicRanges)
gr <- GRanges("A", IRanges(c(10, 20, 22), width=5), "+")
shift(gr, 1)                            # intra-range
## GRanges object with 3 ranges and 0 metadata columns:
##       seqnames    ranges strand
##          <Rle> <IRanges>  <Rle>
##   [1]        A     11-15      +
##   [2]        A     21-25      +
##   [3]        A     23-27      +
##   -------
##   seqinfo: 1 sequence from an unspecified genome; no seqlengths
range(gr)                               # inter-range
## GRanges object with 1 range and 0 metadata columns:
##       seqnames    ranges strand
##          <Rle> <IRanges>  <Rle>
##   [1]        A     10-26      +
##   -------
##   seqinfo: 1 sequence from an unspecified genome; no seqlengths
reduce(gr)                              # inter-range
## GRanges object with 2 ranges and 0 metadata columns:
##       seqnames    ranges strand
##          <Rle> <IRanges>  <Rle>
##   [1]        A     10-14      +
##   [2]        A     20-26      +
##   -------
##   seqinfo: 1 sequence from an unspecified genome; no seqlengths
snps <- GRanges("A", IRanges(c(11, 17, 24), width=1))
findOverlaps(snps, gr)                  # between-range
## Hits object with 3 hits and 0 metadata columns:
##       queryHits subjectHits
##       <integer>   <integer>
##   [1]         1           1
##   [2]         3           2
##   [3]         3           3
##   -------
##   queryLength: 3 / subjectLength: 3
setdiff(range(gr), gr)                  # 'introns'
## GRanges object with 1 range and 0 metadata columns:
##       seqnames    ranges strand
##          <Rle> <IRanges>  <Rle>
##   [1]        A     15-19      +
##   -------
##   seqinfo: 1 sequence from an unspecified genome; no seqlengths

1.4 SummarizedExperiment

1.4.1 The SummarizedExperiment package

Alt SummarizedExperiment

Alt SummarizedExperiment

  • Coordinate feature x sample ‘assays’ with row (feature) and column (sample) descriptions.
  • colData() data frame for desciption of samples
  • rowRanges() GRanges / GRangeList or data frame for description of features
  • exptData() to describe the entire object
  • assays() can be any matrix-like object, including very large on-disk representations such as HDF5Array
library(SummarizedExperiment)
library(airway)
data(airway)
airway
## class: RangedSummarizedExperiment 
## dim: 64102 8 
## metadata(1): ''
## assays(1): counts
## rownames(64102): ENSG00000000003 ENSG00000000005 ... LRG_98 LRG_99
## rowData names(0):
## colnames(8): SRR1039508 SRR1039509 ... SRR1039520 SRR1039521
## colData names(9): SampleName cell ... Sample BioSample
colData(airway)
## DataFrame with 8 rows and 9 columns
##            SampleName     cell      dex    albut        Run avgLength
##              <factor> <factor> <factor> <factor>   <factor> <integer>
## SRR1039508 GSM1275862   N61311    untrt    untrt SRR1039508       126
## SRR1039509 GSM1275863   N61311      trt    untrt SRR1039509       126
## SRR1039512 GSM1275866  N052611    untrt    untrt SRR1039512       126
## SRR1039513 GSM1275867  N052611      trt    untrt SRR1039513        87
## SRR1039516 GSM1275870  N080611    untrt    untrt SRR1039516       120
## SRR1039517 GSM1275871  N080611      trt    untrt SRR1039517       126
## SRR1039520 GSM1275874  N061011    untrt    untrt SRR1039520       101
## SRR1039521 GSM1275875  N061011      trt    untrt SRR1039521        98
##            Experiment    Sample    BioSample
##              <factor>  <factor>     <factor>
## SRR1039508  SRX384345 SRS508568 SAMN02422669
## SRR1039509  SRX384346 SRS508567 SAMN02422675
## SRR1039512  SRX384349 SRS508571 SAMN02422678
## SRR1039513  SRX384350 SRS508572 SAMN02422670
## SRR1039516  SRX384353 SRS508575 SAMN02422682
## SRR1039517  SRX384354 SRS508576 SAMN02422673
## SRR1039520  SRX384357 SRS508579 SAMN02422683
## SRR1039521  SRX384358 SRS508580 SAMN02422677
head(assay(airway))
##                 SRR1039508 SRR1039509 SRR1039512 SRR1039513 SRR1039516
## ENSG00000000003        679        448        873        408       1138
## ENSG00000000005          0          0          0          0          0
## ENSG00000000419        467        515        621        365        587
## ENSG00000000457        260        211        263        164        245
## ENSG00000000460         60         55         40         35         78
## ENSG00000000938          0          0          2          0          1
##                 SRR1039517 SRR1039520 SRR1039521
## ENSG00000000003       1047        770        572
## ENSG00000000005          0          0          0
## ENSG00000000419        799        417        508
## ENSG00000000457        331        233        229
## ENSG00000000460         63         76         60
## ENSG00000000938          0          0          0
airway[, airway$dex %in% "trt"]
## class: RangedSummarizedExperiment 
## dim: 64102 4 
## metadata(1): ''
## assays(1): counts
## rownames(64102): ENSG00000000003 ENSG00000000005 ... LRG_98 LRG_99
## rowData names(0):
## colnames(4): SRR1039509 SRR1039513 SRR1039517 SRR1039521
## colData names(9): SampleName cell ... Sample BioSample
chr14 <- as(seqinfo(rowRanges(airway)), "GRanges")["14"]
airway[airway %over% chr14,]
## class: RangedSummarizedExperiment 
## dim: 2244 8 
## metadata(1): ''
## assays(1): counts
## rownames(2244): ENSG00000006432 ENSG00000009830 ...
##   ENSG00000273259 ENSG00000273307
## rowData names(0):
## colnames(8): SRR1039508 SRR1039509 ... SRR1039520 SRR1039521
## colData names(9): SampleName cell ... Sample BioSample

The object allows very easy access to the assay, for instance to determine library size (total number of mapped reads in each sample)

colSums(assay(airway))
## SRR1039508 SRR1039509 SRR1039512 SRR1039513 SRR1039516 SRR1039517 
##   20637971   18809481   25348649   15163415   24448408   30818215 
## SRR1039520 SRR1039521 
##   19126151   21164133

and average log count number across genes with non-zero counts

library(ggplot2)
ridx <- rowSums(assay(airway)) > 0
se <- airway[ridx,]

ave_log_expr <- rowMeans(log(1 + assay(se)))
tbl <- tibble::enframe(ave_log_expr, "gene", "ave_log_expr")
ggplot(tbl, aes(ave_log_expr)) + 
    geom_density()

1.5 S4Vectors

NumericList and friend

  • List of elements of the same type
  • Useful functions projected into list elements
  • unlist() / relist() for fast operations
il = IntegerList(sample(26, 5), sample(26, 7))
il > 7
## LogicalList of length 2
## [[1]] TRUE TRUE TRUE TRUE TRUE
## [[2]] TRUE TRUE TRUE TRUE FALSE FALSE TRUE
any(il > 7)
## [1] TRUE TRUE
il[il > 7]
## IntegerList of length 2
## [[1]] 12 26 18 15 9
## [[2]] 13 16 21 10 17
relist(letters[unlist(il)], il)
## CharacterList of length 2
## [[1]] l z r o i
## [[2]] m p u j e a q

DataFrame

  • Columns can be anything with a length(), [, and [<- methods.
DataFrame(
    i = 1:2,
    il = IntegerList(sample(5), sample(7)),
    dna = DNAStringSet(c("ATCG", "AAACGGG")),
    gr = GRanges(c("chr1:1-20", "chr20:10-30"))
)
## DataFrame with 2 rows and 4 columns
##           i            il            dna          gr
##   <integer> <IntegerList> <DNAStringSet>   <GRanges>
## 1         1     3,4,5,...           ATCG   chr1:1-20
## 2         2     6,4,3,...        AAACGGG chr20:10-30

2 From files to Bioconductor objects

2.1 BED, GFF, GTF, WIG import and export

2.1.1 Format

  • Genome annotations: BED, WIG, GTF, etc. files.
  • See UCSC data file format descriptions

E.g., GTF:

  • Component coordinates

    7   protein_coding  gene        27221129    27224842    .   -   . ...
...
7   protein_coding  transcript  27221134    27224835    .   -   . ...
7   protein_coding  exon        27224055    27224835    .   -   . ...
7   protein_coding  CDS         27224055    27224763    .   -   0 ...
7   protein_coding  start_codon 27224761    27224763    .   -   0 ...
7   protein_coding  exon        27221134    27222647    .   -   . ...
7   protein_coding  CDS         27222418    27222647    .   -   2 ...
7   protein_coding  stop_codon  27222415    27222417    .   -   0 ...
7   protein_coding  UTR         27224764    27224835    .   -   . ...
7   protein_coding  UTR         27221134    27222414    .   -   . ...

  • Annotations

    gene_id "ENSG00000005073"; gene_name "HOXA11"; gene_source "ensembl_havana"; gene_biotype "protein_coding";
...
... transcript_id "ENST00000006015"; transcript_name "HOXA11-001"; transcript_source "ensembl_havana"; tag "CCDS"; ccds_id "CCDS5411";
... exon_number "1"; exon_id "ENSE00001147062";
... exon_number "1"; protein_id "ENSP00000006015";
... exon_number "1";
... exon_number "2"; exon_id "ENSE00002099557";
... exon_number "2"; protein_id "ENSP00000006015";
... exon_number "2";
...

2.1.2 The rtracklayer package

  • import(): import various formats to GRanges and similar instances
  • export(): transform from GRanges and similar types to BED, GTF, …
  • Respects Bioconductor 1-based convention for nucleotide numbering
  • Also, functions to interactively drive UCSC genome browser with data from R / Bioconductor
library(rtracklayer)
data(cpgIslands, package="Gviz")
cpgIslands$name <- letters[1:10]
cpgIslands$score <- sample(10)
cpgIslands
## GRanges object with 10 ranges and 2 metadata columns:
##        seqnames            ranges strand |        name     score
##           <Rle>         <IRanges>  <Rle> | <character> <integer>
##    [1]     chr7 26549019-26550183      * |           a         9
##    [2]     chr7 26564119-26564500      * |           b         1
##    [3]     chr7 26585667-26586158      * |           c         7
##    [4]     chr7 26591772-26593309      * |           d         4
##    [5]     chr7 26594192-26594570      * |           e         8
##    [6]     chr7 26623835-26624150      * |           f         3
##    [7]     chr7 26659284-26660352      * |           g         2
##    [8]     chr7 26721294-26721717      * |           h        10
##    [9]     chr7 26821518-26823297      * |           i         6
##   [10]     chr7 26991322-26991841      * |           j         5
##   -------
##   seqinfo: 1 sequence from hg19 genome; no seqlengths
bed_file <- tempfile(fileext = ".bed")
basename(bed_file)
## [1] "file5af33bf55cd0.bed"
export(cpgIslands, bed_file)
cat(readLines(bed_file), sep = "\n")
## chr7 26549018    26550183    a   9   .
## chr7 26564118    26564500    b   1   .
## chr7 26585666    26586158    c   7   .
## chr7 26591771    26593309    d   4   .
## chr7 26594191    26594570    e   8   .
## chr7 26623834    26624150    f   3   .
## chr7 26659283    26660352    g   2   .
## chr7 26721293    26721717    h   10  .
## chr7 26821517    26823297    i   6   .
## chr7 26991321    26991841    j   5   .
import(bed_file)
## GRanges object with 10 ranges and 2 metadata columns:
##        seqnames            ranges strand |        name     score
##           <Rle>         <IRanges>  <Rle> | <character> <numeric>
##    [1]     chr7 26549019-26550183      * |           a         9
##    [2]     chr7 26564119-26564500      * |           b         1
##    [3]     chr7 26585667-26586158      * |           c         7
##    [4]     chr7 26591772-26593309      * |           d         4
##    [5]     chr7 26594192-26594570      * |           e         8
##    [6]     chr7 26623835-26624150      * |           f         3
##    [7]     chr7 26659284-26660352      * |           g         2
##    [8]     chr7 26721294-26721717      * |           h        10
##    [9]     chr7 26821518-26823297      * |           i         6
##   [10]     chr7 26991322-26991841      * |           j         5
##   -------
##   seqinfo: 1 sequence from an unspecified genome; no seqlengths
gtf <- system.file(
    package = "airway", 
    "extdata", "Homo_sapiens.GRCh37.75_subset.gtf"
)
import(gtf)
## GRanges object with 891 ranges and 16 metadata columns:
##         seqnames            ranges strand |               source
##            <Rle>         <IRanges>  <Rle> |             <factor>
##     [1]        1 11006528-11009808      - |      retained_intron
##     [2]        1 11007700-11009808      - |      retained_intron
##     [3]        1 11006528-11006795      - |      retained_intron
##     [4]        1 11009681-11009871      - |       protein_coding
##     [5]        1 11009681-11009871      - |       protein_coding
##     ...      ...               ...    ... .                  ...
##   [887]        1 11126678-11141274      - |      retained_intron
##   [888]        1 11126678-11159894      - |       protein_coding
##   [889]        1 11140758-11142680      - | processed_transcript
##   [890]        1 11166592-11322564      - |       protein_coding
##   [891]        1 11166592-11322564      - |       protein_coding
##               type     score     phase         gene_id   transcript_id
##           <factor> <numeric> <integer>     <character>     <character>
##     [1] transcript      <NA>      <NA> ENSG00000175262 ENST00000476357
##     [2]       exon      <NA>      <NA> ENSG00000175262 ENST00000476357
##     [3]       exon      <NA>      <NA> ENSG00000175262 ENST00000476357
##     [4]       exon      <NA>      <NA> ENSG00000175262 ENST00000418570
##     [5]        CDS      <NA>         2 ENSG00000175262 ENST00000418570
##     ...        ...       ...       ...             ...             ...
##   [887] transcript      <NA>      <NA> ENSG00000171824 ENST00000474216
##   [888] transcript      <NA>      <NA> ENSG00000171824 ENST00000544779
##   [889] transcript      <NA>      <NA> ENSG00000171824 ENST00000485606
##   [890]       gene      <NA>      <NA> ENSG00000198793            <NA>
##   [891] transcript      <NA>      <NA> ENSG00000198793 ENST00000361445
##           gene_name    gene_source   gene_biotype transcript_name
##         <character>    <character>    <character>     <character>
##     [1]    C1orf127 ensembl_havana protein_coding    C1orf127-002
##     [2]    C1orf127 ensembl_havana protein_coding    C1orf127-002
##     [3]    C1orf127 ensembl_havana protein_coding    C1orf127-002
##     [4]    C1orf127 ensembl_havana protein_coding    C1orf127-001
##     [5]    C1orf127 ensembl_havana protein_coding    C1orf127-001
##     ...         ...            ...            ...             ...
##   [887]     EXOSC10 ensembl_havana protein_coding     EXOSC10-003
##   [888]     EXOSC10 ensembl_havana protein_coding     EXOSC10-201
##   [889]     EXOSC10 ensembl_havana protein_coding     EXOSC10-011
##   [890]        MTOR ensembl_havana protein_coding            <NA>
##   [891]        MTOR ensembl_havana protein_coding        MTOR-001
##         transcript_source exon_number         exon_id           tag
##               <character> <character>     <character>   <character>
##     [1]            havana        <NA>            <NA>          <NA>
##     [2]            havana           1 ENSE00001869344          <NA>
##     [3]            havana           2 ENSE00001938325          <NA>
##     [4]            havana           6 ENSE00001262890 mRNA_start_NF
##     [5]            havana           6            <NA> mRNA_start_NF
##     ...               ...         ...             ...           ...
##   [887]            havana        <NA>            <NA>          <NA>
##   [888]           ensembl        <NA>            <NA>          <NA>
##   [889]            havana        <NA>            <NA>          <NA>
##   [890]              <NA>        <NA>            <NA>          <NA>
##   [891]    ensembl_havana        <NA>            <NA>          CCDS
##              protein_id     ccds_id
##             <character> <character>
##     [1]            <NA>        <NA>
##     [2]            <NA>        <NA>
##     [3]            <NA>        <NA>
##     [4]            <NA>        <NA>
##     [5] ENSP00000387816        <NA>
##     ...             ...         ...
##   [887]            <NA>        <NA>
##   [888]            <NA>        <NA>
##   [889]            <NA>        <NA>
##   [890]            <NA>        <NA>
##   [891]            <NA>     CCDS127
##   -------
##   seqinfo: 1 sequence from an unspecified genome; no seqlengths
## see also `GenonmicFeatures::makeTxDbFromGFF()`

2.2 FASTQ files

2.2.1 Format

  • Sequenced reads: FASTQ files

      @ERR127302.1703 HWI-EAS350_0441:1:1:1460:19184#0/1
  CCTGAGTGAAGCTGATCTTGATCTACGAAGAGAGATAGATCTTGATCGTCGAGGAGATGCTGACCTTGACCT
  +
  HHGHHGHHHHHHHHDGG<GDGGE@GDGGD<?B8??ADAD<BE@EE8EGDGA3CB85*,77@>>CE?=896=:
  @ERR127302.1704 HWI-EAS350_0441:1:1:1460:16861#0/1
  GCGGTATGCTGGAAGGTGCTCGAATGGAGAGCGCCAGCGCCCCGGCGCTGAGCCGCAGCCTCAGGTCCGCCC
  +
  DE?DD>ED4>EEE>DE8EEEDE8B?EB<@3;BA79?,881B?@73;1?########################

2.2.2 The ShortRead package

  • readFastq(): input
  • FastqStreamer(): iterate through FASTQ files
  • FastqSampler(): sample from FASTQ files, e.g., for quality assessment
  • Functions for trimming and filters FASTQ files, QA assessment

2.3 Aligned reads

  • Aligned reads: BAM files

  • Header

      @HD     VN:1.0  SO:coordinate
  @SQ     SN:chr1 LN:249250621
  @SQ     SN:chr10        LN:135534747
  @SQ     SN:chr11        LN:135006516
  ...
  @SQ     SN:chrY LN:59373566
  @PG     ID:TopHat       VN:2.0.8b       CL:/home/hpages/tophat-2.0.8b.Linux_x86_64/tophat --mate-inner-dist 150 --solexa-quals --max-multihits 5 --no-discordant --no-mixed --coverage-search --microexon-search --library-type fr-unstranded --num-threads 2 --output-dir tophat2_out/ERR127306 /home/hpages/bowtie2-2.1.0/indexes/hg19 fastq/ERR127306_1.fastq fastq/ERR127306_2.fastq

  • Alignments: ID, flag, alignment and mate

      ERR127306.7941162       403     chr14   19653689        3       72M             =       19652348        -1413  ...
  ERR127306.22648137      145     chr14   19653692        1       72M             =       19650044        -3720  ...
  ERR127306.933914        339     chr14   19653707        1       66M120N6M       =       19653686        -213   ...

  • Alignments: sequence and quality

      ... GAATTGATCAGTCTCATCTGAGAGTAACTTTGTACCCATCACTGATTCCTTCTGAGACTGCCTCCACTTCCC        *'%%%%%#&&%''#'&%%%)&&%%$%%'%%'&*****$))$)'')'%)))&)%%%%$'%%%%&"))'')%))
  ... TTGATCAGTCTCATCTGAGAGTAACTTTGTACCCATCACTGATTCCTTCTGAGACTGCCTCCACTTCCCCAG        '**)****)*'*&*********('&)****&***(**')))())%)))&)))*')&***********)****
  ... TGAGAGTAACTTTGTACCCATCACTGATTCCTTCTGAGACTGCCTCCACTTCCCCAGCAGCCTCTGGTTTCT        '******&%)&)))&")')'')'*((******&)&'')'))$))'')&))$)**&&****************

  • Alignments: Tags

      ... AS:i:0  XN:i:0  XM:i:0  XO:i:0  XG:i:0  NM:i:0  MD:Z:72 YT:Z:UU NH:i:2  CC:Z:chr22      CP:i:16189276   HI:i:0
  ... AS:i:0  XN:i:0  XM:i:0  XO:i:0  XG:i:0  NM:i:0  MD:Z:72 YT:Z:UU NH:i:3  CC:Z:=  CP:i:19921600   HI:i:0
  ... AS:i:0  XN:i:0  XM:i:0  XO:i:0  XG:i:0  NM:i:4  MD:Z:72 YT:Z:UU XS:A:+  NH:i:3  CC:Z:=  CP:i:19921465   HI:i:0
  ... AS:i:0  XN:i:0  XM:i:0  XO:i:0  XG:i:0  NM:i:4  MD:Z:72 YT:Z:UU XS:A:+  NH:i:2  CC:Z:chr22      CP:i:16189138   HI:i:0

2.3.1 The GenomicAlignments package

  • readGAlignments(): Single-end reads
  • readGAlignmentPairs(), readGAlignmentsList(): paired end reads
library(GenomicAlignments)
## Loading required package: Rsamtools
fls <- dir(
    system.file(package = "airway", "extdata"),
    pattern = "bam",
    full.names = TRUE
)
readGAlignments(fls[1])
## GAlignments object with 14282 alignments and 0 metadata columns:
##           seqnames strand       cigar    qwidth     start       end
##              <Rle>  <Rle> <character> <integer> <integer> <integer>
##       [1]        1      +         63M        63  11053773  11053835
##       [2]        1      -         63M        63  11053840  11053902
##       [3]        1      +         63M        63  11067866  11067928
##       [4]        1      -         63M        63  11067931  11067993
##       [5]        1      +         63M        63  11072708  11072770
##       ...      ...    ...         ...       ...       ...       ...
##   [14278]        1      -         63M        63  11364733  11364795
##   [14279]        1      +         63M        63  11365866  11365928
##   [14280]        1      -         63M        63  11365987  11366049
##   [14281]        1      +       2S61M        63  11386063  11386123
##   [14282]        1      -         63M        63  11386132  11386194
##               width     njunc
##           <integer> <integer>
##       [1]        63         0
##       [2]        63         0
##       [3]        63         0
##       [4]        63         0
##       [5]        63         0
##       ...       ...       ...
##   [14278]        63         0
##   [14279]        63         0
##   [14280]        63         0
##   [14281]        61         0
##   [14282]        63         0
##   -------
##   seqinfo: 84 sequences from an unspecified genome

2.4 Called variants: VCF files

  • Header

        ##fileformat=VCFv4.2
    ##fileDate=20090805
    ##source=myImputationProgramV3.1
    ##reference=file:///seq/references/1000GenomesPilot-NCBI36.fasta
    ##contig=<ID=20,length=62435964,assembly=B36,md5=f126cdf8a6e0c7f379d618ff66beb2da,species="Homo sapiens",taxonomy=x>
    ##phasing=partial
    ##INFO=<ID=DP,Number=1,Type=Integer,Description="Total Depth">
    ##INFO=<ID=AF,Number=A,Type=Float,Description="Allele Frequency">
    ...
    ##FILTER=<ID=q10,Description="Quality below 10">
    ##FILTER=<ID=s50,Description="Less than 50% of samples have data">
    ...
    ##FORMAT=<ID=GT,Number=1,Type=String,Description="Genotype">
    ##FORMAT=<ID=GQ,Number=1,Type=Integer,Description="Genotype Quality">

  • Location

        #CHROM POS     ID        REF    ALT     QUAL FILTER ...
    20     14370   rs6054257 G      A       29   PASS   ...
    20     17330   .         T      A       3    q10    ...
    20     1110696 rs6040355 A      G,T     67   PASS   ...

  • Variant INFO

        #CHROM POS     ...    INFO                              ...
    20     14370   ...    NS=3;DP=14;AF=0.5;DB;H2           ...
    20     17330   ...    NS=3;DP=11;AF=0.017               ...
    20     1110696 ...    NS=2;DP=10;AF=0.333,0.667;AA=T;DB ...

  • Genotype FORMAT and samples

        ... POS     ...  FORMAT      NA00001        NA00002        NA00003
    ... 14370   ...  GT:GQ:DP:HQ 0|0:48:1:51,51 1|0:48:8:51,51 1/1:43:5:.,.
    ... 17330   ...  GT:GQ:DP:HQ 0|0:49:3:58,50 0|1:3:5:65,3   0/0:41:3
    ... 1110696 ...  GT:GQ:DP:HQ 1|2:21:6:23,27 2|1:2:0:18,2   2/2:35:4

2.4.1 VariantAnnotation

  • readVcf(): VCF input
  • ScanVcfParam(): restrict input to necessary fields / ranges
  • VcfFile(): indexing and iterating through large VCF files
  • locateVariants(): annotate in relation to genes, etc; see also ensemblVEP, VariantFiltering
  • filterVcf(): flexible filtering

3 Working with large files

Example: BAM file

Restrict input:

library(GenomicAlignments)
fl <- dir(
    system.file(package = "airway", "extdata"),
    pattern = "bam", full.name = TRUE
)
fl[1]
## [1] "/Users/ma38727/Library/R/3.6/Bioc/3.10/airway/extdata/SRR1039508_subset.bam"
readGAlignments(fl[1])
## GAlignments object with 14282 alignments and 0 metadata columns:
##           seqnames strand       cigar    qwidth     start       end
##              <Rle>  <Rle> <character> <integer> <integer> <integer>
##       [1]        1      +         63M        63  11053773  11053835
##       [2]        1      -         63M        63  11053840  11053902
##       [3]        1      +         63M        63  11067866  11067928
##       [4]        1      -         63M        63  11067931  11067993
##       [5]        1      +         63M        63  11072708  11072770
##       ...      ...    ...         ...       ...       ...       ...
##   [14278]        1      -         63M        63  11364733  11364795
##   [14279]        1      +         63M        63  11365866  11365928
##   [14280]        1      -         63M        63  11365987  11366049
##   [14281]        1      +       2S61M        63  11386063  11386123
##   [14282]        1      -         63M        63  11386132  11386194
##               width     njunc
##           <integer> <integer>
##       [1]        63         0
##       [2]        63         0
##       [3]        63         0
##       [4]        63         0
##       [5]        63         0
##       ...       ...       ...
##   [14278]        63         0
##   [14279]        63         0
##   [14280]        63         0
##   [14281]        61         0
##   [14282]        63         0
##   -------
##   seqinfo: 84 sequences from an unspecified genome
## hack: index the bam file in-place
invisible(indexBam(fl[1]))

which <- GRanges(c("1:11053773-11072770", "1:11362290-11386194"))
param <- ScanBamParam(which = which, what = "seq")
readGAlignments(fl[1], param = param)
## GAlignments object with 86 alignments and 1 metadata column:
##        seqnames strand       cigar    qwidth     start       end     width
##           <Rle>  <Rle> <character> <integer> <integer> <integer> <integer>
##    [1]        1      +         63M        63  11053773  11053835        63
##    [2]        1      -         63M        63  11053840  11053902        63
##    [3]        1      +         63M        63  11067866  11067928        63
##    [4]        1      -         63M        63  11067931  11067993        63
##    [5]        1      +         63M        63  11072708  11072770        63
##    ...      ...    ...         ...       ...       ...       ...       ...
##   [82]        1      -         63M        63  11364733  11364795        63
##   [83]        1      +         63M        63  11365866  11365928        63
##   [84]        1      -         63M        63  11365987  11366049        63
##   [85]        1      +       2S61M        63  11386063  11386123        61
##   [86]        1      -         63M        63  11386132  11386194        63
##            njunc |                     seq
##        <integer> |          <DNAStringSet>
##    [1]         0 | ATACAAAAAT...GAAGCTGAGG
##    [2]         0 | AGAATCACTT...TGCACTCCAG
##    [3]         0 | CTAAAAACAT...TTACTTTATT
##    [4]         0 | TTTATTACTT...ACCTCCGCCA
##    [5]         0 | GCCATTTTGT...TTCGGTGTCC
##    ...       ... .                     ...
##   [82]         0 | CCCCGGCCCA...GTGTGGGAAG
##   [83]         0 | CTCCTCACTT...AGACAGGGCG
##   [84]         0 | TCACCTCCCA...GGGGCGGCGG
##   [85]         0 | GGGCAGTGCA...TTGGGCCAAA
##   [86]         0 | TTCTCTGGGT...GAGAAGCTAC
##   -------
##   seqinfo: 84 sequences from an unspecified genome

Iterate:

bf <- BamFile(fl[1], yieldSize = 5000)

open(bf)
repeat {
    galn <- readGAlignments(bf)
    if (length(galn) == 0)
        break
    ## do work
    message(length(galn))
}
## 5000
## 5000
## 4282
close(bf)

4 Provenance

sessionInfo()
## R version 3.6.0 Patched (2019-04-26 r76431)
## Platform: x86_64-apple-darwin17.7.0 (64-bit)
## Running under: macOS High Sierra 10.13.6
## 
## Matrix products: default
## BLAS:   /Users/ma38727/bin/R-3-6-branch/lib/libRblas.dylib
## LAPACK: /Users/ma38727/bin/R-3-6-branch/lib/libRlapack.dylib
## 
## locale:
## [1] en_US.UTF-8/en_US.UTF-8/en_US.UTF-8/C/en_US.UTF-8/en_US.UTF-8
## 
## attached base packages:
## [1] stats4    parallel  stats     graphics  grDevices utils     datasets 
## [8] methods   base     
## 
## other attached packages:
##  [1] GenomicAlignments_1.21.4    Rsamtools_2.1.2            
##  [3] rtracklayer_1.45.1          ggplot2_3.2.0              
##  [5] airway_1.5.0                SummarizedExperiment_1.15.5
##  [7] DelayedArray_0.11.2         BiocParallel_1.19.0        
##  [9] matrixStats_0.54.0          Biobase_2.45.0             
## [11] GenomicRanges_1.37.14       GenomeInfoDb_1.21.1        
## [13] Biostrings_2.53.0           XVector_0.25.0             
## [15] IRanges_2.19.10             S4Vectors_0.23.17          
## [17] BiocGenerics_0.31.4         BiocStyle_2.13.2           
## 
## loaded via a namespace (and not attached):
##  [1] tidyselect_0.2.5       xfun_0.8               purrr_0.3.2           
##  [4] lattice_0.20-38        colorspace_1.4-1       htmltools_0.3.6       
##  [7] yaml_2.2.0             XML_3.98-1.20          rlang_0.4.0           
## [10] pillar_1.4.2           glue_1.3.1             withr_2.1.2           
## [13] GenomeInfoDbData_1.2.1 stringr_1.4.0          zlibbioc_1.31.0       
## [16] munsell_0.5.0          gtable_0.3.0           codetools_0.2-16      
## [19] evaluate_0.14          labeling_0.3           knitr_1.23            
## [22] Rcpp_1.0.1             scales_1.0.0           BiocManager_1.30.5.1  
## [25] digest_0.6.19          stringi_1.4.3          bookdown_0.11         
## [28] dplyr_0.8.2            grid_3.6.0             tools_3.6.0           
## [31] bitops_1.0-6           magrittr_1.5           RCurl_1.95-4.12       
## [34] lazyeval_0.2.2         tibble_2.1.3           crayon_1.3.4          
## [37] pkgconfig_2.0.2        Matrix_1.2-17          assertthat_0.2.1      
## [40] rmarkdown_1.13         R6_2.4.0               compiler_3.6.0